Incidental Mutation 'R4814:Zfp982'
ID369626
Institutional Source Beutler Lab
Gene Symbol Zfp982
Ensembl Gene ENSMUSG00000078496
Gene Namezinc finger protein 982
SynonymsGm13152
MMRRC Submission 042432-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock #R4814 (G1)
Quality Score132
Status Validated
Chromosome4
Chromosomal Location147492417-147513486 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 147512633 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 149 (Q149R)
Ref Sequence ENSEMBL: ENSMUSP00000101346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063704] [ENSMUST00000105721]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063704
AA Change: Q149R

PolyPhen 2 Score 0.578 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000068021
Gene: ENSMUSG00000078496
AA Change: Q149R

DomainStartEndE-ValueType
KRAB 13 72 6.26e-16 SMART
ZnF_C2H2 102 124 1.68e1 SMART
ZnF_C2H2 130 152 1.82e-3 SMART
ZnF_C2H2 158 180 7.55e-1 SMART
ZnF_C2H2 186 208 8.47e-4 SMART
ZnF_C2H2 214 236 1.28e-3 SMART
ZnF_C2H2 242 264 9.73e-4 SMART
ZnF_C2H2 270 292 4.94e-5 SMART
ZnF_C2H2 298 320 5.29e-5 SMART
ZnF_C2H2 326 348 2.43e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105721
AA Change: Q149R

PolyPhen 2 Score 0.578 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101346
Gene: ENSMUSG00000078496
AA Change: Q149R

DomainStartEndE-ValueType
KRAB 13 72 6.26e-16 SMART
ZnF_C2H2 102 124 1.68e1 SMART
ZnF_C2H2 130 152 1.82e-3 SMART
ZnF_C2H2 158 180 7.55e-1 SMART
ZnF_C2H2 186 208 8.47e-4 SMART
ZnF_C2H2 214 236 1.28e-3 SMART
ZnF_C2H2 242 264 9.73e-4 SMART
ZnF_C2H2 270 292 4.94e-5 SMART
ZnF_C2H2 298 320 5.29e-5 SMART
ZnF_C2H2 326 348 2.43e-4 SMART
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T G 16: 56,650,753 V587G probably benign Het
Abtb2 A G 2: 103,717,287 D1002G probably benign Het
Acap2 A G 16: 31,108,126 S524P probably benign Het
Acsm1 A T 7: 119,655,464 I385L probably benign Het
Adra1a C G 14: 66,638,032 A152G probably benign Het
Agbl4 A T 4: 111,656,368 Y437F possibly damaging Het
Amt A G 9: 108,299,780 T196A probably benign Het
Apobr G A 7: 126,586,687 V457M probably benign Het
Birc6 A G 17: 74,649,672 K3563E probably damaging Het
Cdadc1 AGACGGA AGA 14: 59,568,991 probably null Het
Chrna9 T C 5: 65,977,149 W448R probably damaging Het
Cyp4a31 A T 4: 115,570,269 D224V probably damaging Het
Ddx10 C A 9: 53,204,105 R643L possibly damaging Het
Dip2c A G 13: 9,536,860 H200R probably benign Het
Dnah8 A T 17: 30,767,924 R3182S probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Egfr T C 11: 16,869,354 C295R probably damaging Het
Garem1 A T 18: 21,148,116 N394K probably damaging Het
Gcat T C 15: 79,031,122 probably null Het
Gckr C T 5: 31,298,300 Q66* probably null Het
Gm26996 A T 6: 130,579,354 noncoding transcript Het
Gm9386 C A 17: 80,938,712 noncoding transcript Het
Gpr6 A T 10: 41,071,262 M108K possibly damaging Het
H2-Q10 A C 17: 35,473,584 probably benign Het
Hpf1 A G 8: 60,893,807 D52G probably damaging Het
Jak2 A G 19: 29,301,977 R989G probably damaging Het
Kat7 A G 11: 95,303,123 probably benign Het
Kcnn3 G T 3: 89,662,724 V615F probably damaging Het
Lgi1 G T 19: 38,300,878 probably null Het
Lrrtm4 A T 6: 80,023,134 T510S possibly damaging Het
Map7d1 A G 4: 126,234,321 probably null Het
Mapt T C 11: 104,298,960 V252A probably benign Het
Mbd4 A T 6: 115,849,299 S223T possibly damaging Het
Meig1 T A 2: 3,411,922 I21L probably benign Het
Mia3 A G 1: 183,332,830 Y447H probably damaging Het
Mrpl46 A C 7: 78,780,595 N142K probably benign Het
Myo18a C A 11: 77,859,236 probably benign Het
Nup188 A G 2: 30,326,511 T776A possibly damaging Het
Oas1h C A 5: 120,862,665 H113N probably damaging Het
Olfr1505 A T 19: 13,919,453 L144F possibly damaging Het
Olfr771 T A 10: 129,160,376 T203S possibly damaging Het
Olfr830 A G 9: 18,875,917 I197V probably benign Het
Olfr845 C T 9: 19,339,180 T240M probably damaging Het
Orc3 T A 4: 34,572,450 probably benign Het
Osbpl3 T A 6: 50,353,000 L65F probably damaging Het
Papola C A 12: 105,799,653 P4Q probably damaging Het
Pepd A G 7: 34,945,597 N151S probably damaging Het
Plekhm2 A G 4: 141,627,839 L959P probably benign Het
Prpf40a A T 2: 53,190,020 H82Q probably damaging Het
Robo1 C T 16: 72,972,035 T496M probably benign Het
Samd9l T G 6: 3,372,863 Q1466P probably damaging Het
Serpina1a T C 12: 103,854,763 T342A probably benign Het
Serpina3i A G 12: 104,265,211 T36A probably benign Het
Serpinb5 G T 1: 106,872,339 L86F probably damaging Het
Slc35g1 A G 19: 38,402,827 S186G possibly damaging Het
Slco6d1 T A 1: 98,423,174 D126E probably benign Het
Smchd1 A G 17: 71,411,768 probably null Het
Smpdl3a C A 10: 57,811,241 T355K probably damaging Het
Sntg2 A G 12: 30,373,268 probably benign Het
Sox14 T A 9: 99,875,231 M152L probably benign Het
Spats2l G T 1: 57,937,926 A308S possibly damaging Het
Tcf12 T C 9: 71,870,041 probably benign Het
Tcf7l2 T A 19: 55,924,072 C478* probably null Het
Tekt5 A G 16: 10,382,907 L250P probably damaging Het
Tmem132d T G 5: 127,984,264 I425L probably benign Het
Tmem174 T A 13: 98,636,948 I125F probably damaging Het
Trafd1 T G 5: 121,374,016 I404L probably benign Het
Trpm5 G A 7: 143,082,636 P500S possibly damaging Het
Trpm6 T A 19: 18,862,212 N1616K probably benign Het
Vmn1r4 A G 6: 56,956,730 D73G possibly damaging Het
Vmn2r85 T A 10: 130,418,698 I706F probably benign Het
Zc3h14 C G 12: 98,752,848 D157E probably damaging Het
Other mutations in Zfp982
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Zfp982 APN 4 147512369 missense probably benign
IGL02989:Zfp982 APN 4 147512595 missense possibly damaging 0.47
R0035:Zfp982 UTSW 4 147512692 missense probably benign 0.00
R0123:Zfp982 UTSW 4 147512636 missense probably benign 0.04
R1502:Zfp982 UTSW 4 147512669 missense probably benign 0.00
R1982:Zfp982 UTSW 4 147512592 nonsense probably null
R4181:Zfp982 UTSW 4 147512693 missense probably benign 0.00
R4182:Zfp982 UTSW 4 147512693 missense probably benign 0.00
R4183:Zfp982 UTSW 4 147512693 missense probably benign 0.00
R4184:Zfp982 UTSW 4 147512693 missense probably benign 0.00
R4427:Zfp982 UTSW 4 147512623 nonsense probably null
R5697:Zfp982 UTSW 4 147512589 missense probably benign 0.02
R5777:Zfp982 UTSW 4 147510864 missense probably damaging 1.00
R7233:Zfp982 UTSW 4 147513261 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGTACATTGTCCATGAACACATG -3'
(R):5'- GATGCCTTCTCAGTTTGCG -3'

Sequencing Primer
(F):5'- GCTTAGCAATGTTATTCTTGAATCCC -3'
(R):5'- CTCAGTTTGCGTTTTTCAGTAAAGC -3'
Posted On2016-02-04