Incidental Mutation 'R0420:Zfp345'
ID36964
Institutional Source Beutler Lab
Gene Symbol Zfp345
Ensembl Gene ENSMUSG00000074731
Gene Namezinc finger protein 345
SynonymsOTTMUSG00000015743
MMRRC Submission 038622-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R0420 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location150470991-150485091 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 150473243 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 125 (H125Y)
Ref Sequence ENSEMBL: ENSMUSP00000105540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109914]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109914
AA Change: H125Y

PolyPhen 2 Score 0.738 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105540
Gene: ENSMUSG00000074731
AA Change: H125Y

DomainStartEndE-ValueType
KRAB 4 66 9.5e-20 SMART
ZnF_C2H2 103 125 2e-2 SMART
ZnF_C2H2 131 153 2.9e-6 SMART
ZnF_C2H2 159 181 4.1e-3 SMART
ZnF_C2H2 215 237 2.6e-7 SMART
ZnF_C2H2 243 265 1.6e-5 SMART
ZnF_C2H2 271 293 4e-7 SMART
ZnF_C2H2 299 321 1.1e-5 SMART
ZnF_C2H2 327 349 5.9e-7 SMART
ZnF_C2H2 365 387 4.4e-7 SMART
ZnF_C2H2 393 415 7.3e-6 SMART
ZnF_C2H2 421 443 2.7e-5 SMART
ZnF_C2H2 449 471 1.5e-4 SMART
ZnF_C2H2 477 499 1.3e-5 SMART
ZnF_C2H2 505 527 5.1e-6 SMART
ZnF_C2H2 533 555 9.2e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117906
Meta Mutation Damage Score 0.196 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.2%
Validation Efficiency 100% (76/76)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik A G 15: 98,571,094 S17G probably benign Het
Abcb4 T C 5: 8,941,050 V870A probably benign Het
Adam6b A T 12: 113,489,994 M144L probably benign Het
Adrb2 T A 18: 62,179,539 I72L possibly damaging Het
Ankrd53 A T 6: 83,763,692 H99L probably damaging Het
Ap4e1 C T 2: 127,049,360 T17M probably damaging Het
Arnt T A 3: 95,470,394 probably benign Het
Atp1a3 C T 7: 24,980,627 G884E probably benign Het
Atp6v1b1 T C 6: 83,752,844 probably benign Het
Atp8a2 G T 14: 59,773,744 T971K probably damaging Het
BC048562 A T 9: 108,445,966 T167S probably benign Het
Brd9 A G 13: 73,955,473 M491V probably benign Het
Btnl10 A T 11: 58,923,451 D319V probably damaging Het
Cadps T A 14: 12,491,800 R783S probably damaging Het
Ccdc149 A G 5: 52,400,239 probably benign Het
Ccm2l A T 2: 153,070,862 D107V probably null Het
Cep192 A G 18: 67,813,893 E213G possibly damaging Het
Cyp2c37 A C 19: 39,995,794 N242T probably benign Het
Dnah17 A G 11: 118,039,939 V3750A probably damaging Het
Ehbp1 T A 11: 22,151,836 I231L probably benign Het
Emilin3 A G 2: 160,910,879 probably benign Het
Eya4 T C 10: 23,155,963 N254S possibly damaging Het
Fam184b A G 5: 45,584,512 S126P probably damaging Het
Fancd2 T C 6: 113,536,979 L108P probably damaging Het
Fgf12 A T 16: 28,162,529 M145K possibly damaging Het
Gabbr1 A G 17: 37,046,762 N23S possibly damaging Het
Ggt1 T A 10: 75,576,213 probably benign Het
Gm1966 T A 7: 106,603,883 L51F probably damaging Het
Gm6434 T A 7: 25,882,361 noncoding transcript Het
Gm6614 T G 6: 141,985,477 probably benign Het
Grik4 A T 9: 42,622,096 L376* probably null Het
Gzf1 A G 2: 148,683,833 T75A probably benign Het
Hcn1 T C 13: 117,975,375 I625T unknown Het
Hhat C T 1: 192,552,934 probably null Het
Ifit1bl1 T C 19: 34,594,514 E181G probably damaging Het
Kif21a T C 15: 90,968,054 probably benign Het
Lrrc45 A C 11: 120,715,219 S118R probably damaging Het
Mcm9 T C 10: 53,548,527 I656V probably benign Het
Ms4a5 A G 19: 11,283,654 L47S probably damaging Het
Mynn A T 3: 30,607,459 N230I probably benign Het
Nck2 T C 1: 43,554,118 S162P probably damaging Het
Nfat5 T C 8: 107,367,461 F259S probably damaging Het
Obox1 T G 7: 15,556,253 S174A possibly damaging Het
Ociad1 T A 5: 73,313,429 probably null Het
Pgbd1 A T 13: 21,423,166 V286E possibly damaging Het
Phlpp2 T C 8: 109,939,935 V1032A probably damaging Het
Ppm1e C T 11: 87,240,614 A318T probably damaging Het
Prex1 T A 2: 166,589,571 D757V probably benign Het
Ptpdc1 C A 13: 48,589,119 probably null Het
Rbbp5 T G 1: 132,493,844 I94R possibly damaging Het
Rnpc3 A G 3: 113,621,869 V173A probably benign Het
Sgsm1 A T 5: 113,263,759 N700K probably benign Het
Sox14 T A 9: 99,875,122 H188L probably damaging Het
Supt5 T A 7: 28,317,329 probably benign Het
Synpo A G 18: 60,602,418 S819P probably damaging Het
Tenm2 A G 11: 36,207,124 probably benign Het
Tenm4 T C 7: 96,873,766 V1468A possibly damaging Het
Tiam2 A G 17: 3,502,918 N83S probably benign Het
Tle6 T C 10: 81,595,311 probably benign Het
Tm2d2 T G 8: 25,018,114 N91K probably damaging Het
Tmem132d T G 5: 127,864,646 Q463H probably benign Het
Tmf1 A G 6: 97,176,141 S324P probably damaging Het
Tnc T C 4: 64,000,159 T1172A probably benign Het
Usp17lb A T 7: 104,840,539 C393S probably benign Het
Usp42 G A 5: 143,714,861 L1136F probably damaging Het
Vmn2r92 T G 17: 18,168,921 M499R probably benign Het
Vps54 T A 11: 21,311,071 probably benign Het
Wdr6 C T 9: 108,573,101 R1076H probably benign Het
Wdr72 T A 9: 74,210,757 M917K possibly damaging Het
Wee2 T C 6: 40,456,995 V281A probably benign Het
Zc3h6 A G 2: 129,014,827 D609G probably benign Het
Zhx2 A G 15: 57,821,840 K202E probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Zfp345
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Zfp345 APN 2 150472729 missense probably damaging 1.00
IGL00846:Zfp345 APN 2 150472618 missense possibly damaging 0.76
IGL01020:Zfp345 APN 2 150473047 missense possibly damaging 0.68
IGL01931:Zfp345 APN 2 150473350 missense probably benign 0.38
IGL02237:Zfp345 APN 2 150474885 splice site probably benign
IGL02335:Zfp345 APN 2 150474543 missense possibly damaging 0.92
IGL02592:Zfp345 APN 2 150473309 missense probably benign 0.36
IGL02736:Zfp345 APN 2 150474554 missense probably damaging 0.99
R0095:Zfp345 UTSW 2 150472300 missense probably damaging 1.00
R0096:Zfp345 UTSW 2 150472300 missense probably damaging 1.00
R0143:Zfp345 UTSW 2 150472555 missense probably benign
R0371:Zfp345 UTSW 2 150472063 missense possibly damaging 0.81
R0412:Zfp345 UTSW 2 150473403 missense probably benign 0.00
R0415:Zfp345 UTSW 2 150474559 splice site probably benign
R0697:Zfp345 UTSW 2 150472909 missense probably benign 0.13
R0799:Zfp345 UTSW 2 150472351 missense probably benign 0.27
R1881:Zfp345 UTSW 2 150472355 missense probably damaging 1.00
R1954:Zfp345 UTSW 2 150474821 missense probably damaging 1.00
R2004:Zfp345 UTSW 2 150472118 missense possibly damaging 0.90
R2152:Zfp345 UTSW 2 150472658 missense probably benign 0.00
R2153:Zfp345 UTSW 2 150472658 missense probably benign 0.00
R3051:Zfp345 UTSW 2 150474852 missense probably benign 0.07
R3880:Zfp345 UTSW 2 150472155 missense possibly damaging 0.91
R3939:Zfp345 UTSW 2 150472553 missense probably damaging 1.00
R4801:Zfp345 UTSW 2 150473308 missense possibly damaging 0.91
R4802:Zfp345 UTSW 2 150473308 missense possibly damaging 0.91
R4897:Zfp345 UTSW 2 150472688 missense probably benign 0.05
R5606:Zfp345 UTSW 2 150474868 nonsense probably null
R6009:Zfp345 UTSW 2 150472517 missense probably damaging 1.00
R6191:Zfp345 UTSW 2 150473090 missense probably benign 0.11
R6194:Zfp345 UTSW 2 150472631 missense probably damaging 1.00
R6782:Zfp345 UTSW 2 150473354 missense probably damaging 0.97
R6932:Zfp345 UTSW 2 150473411 missense probably damaging 0.99
Predicted Primers
Posted On2013-05-09