Incidental Mutation 'R4814:Ddx10'
ID369646
Institutional Source Beutler Lab
Gene Symbol Ddx10
Ensembl Gene ENSMUSG00000053289
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 10
Synonyms4632415A01Rik
MMRRC Submission 042432-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R4814 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location53098635-53248053 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 53204105 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 643 (R643L)
Ref Sequence ENSEMBL: ENSMUSP00000065198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065630]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065630
AA Change: R643L

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000065198
Gene: ENSMUSG00000053289
AA Change: R643L

DomainStartEndE-ValueType
low complexity region 24 43 N/A INTRINSIC
DEXDc 88 291 1.74e-53 SMART
HELICc 327 410 8.48e-25 SMART
DUF4217 450 513 6.06e-25 SMART
low complexity region 577 594 N/A INTRINSIC
low complexity region 627 637 N/A INTRINSIC
low complexity region 658 680 N/A INTRINSIC
low complexity region 748 773 N/A INTRINSIC
Meta Mutation Damage Score 0.184 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, and it may be involved in ribosome assembly. Fusion of this gene and the nucleoporin gene, NUP98, by inversion 11 (p15q22) chromosome translocation is found in the patients with de novo or therapy-related myeloid malignancies. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit craniofacial defects, including decreased cranium length, cleft palate, and short snout, and show reduced body size, body weight, lean body mass, and bone mineral content. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T G 16: 56,650,753 V587G probably benign Het
Abtb2 A G 2: 103,717,287 D1002G probably benign Het
Acap2 A G 16: 31,108,126 S524P probably benign Het
Acsm1 A T 7: 119,655,464 I385L probably benign Het
Adra1a C G 14: 66,638,032 A152G probably benign Het
Agbl4 A T 4: 111,656,368 Y437F possibly damaging Het
Amt A G 9: 108,299,780 T196A probably benign Het
Apobr G A 7: 126,586,687 V457M probably benign Het
Birc6 A G 17: 74,649,672 K3563E probably damaging Het
Cdadc1 AGACGGA AGA 14: 59,568,991 probably null Het
Chrna9 T C 5: 65,977,149 W448R probably damaging Het
Cyp4a31 A T 4: 115,570,269 D224V probably damaging Het
Dip2c A G 13: 9,536,860 H200R probably benign Het
Dnah8 A T 17: 30,767,924 R3182S probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Egfr T C 11: 16,869,354 C295R probably damaging Het
Garem1 A T 18: 21,148,116 N394K probably damaging Het
Gcat T C 15: 79,031,122 probably null Het
Gckr C T 5: 31,298,300 Q66* probably null Het
Gm26996 A T 6: 130,579,354 noncoding transcript Het
Gm9386 C A 17: 80,938,712 noncoding transcript Het
Gpr6 A T 10: 41,071,262 M108K possibly damaging Het
H2-Q10 A C 17: 35,473,584 probably benign Het
Hpf1 A G 8: 60,893,807 D52G probably damaging Het
Jak2 A G 19: 29,301,977 R989G probably damaging Het
Kat7 A G 11: 95,303,123 probably benign Het
Kcnn3 G T 3: 89,662,724 V615F probably damaging Het
Lgi1 G T 19: 38,300,878 probably null Het
Lrrtm4 A T 6: 80,023,134 T510S possibly damaging Het
Map7d1 A G 4: 126,234,321 probably null Het
Mapt T C 11: 104,298,960 V252A probably benign Het
Mbd4 A T 6: 115,849,299 S223T possibly damaging Het
Meig1 T A 2: 3,411,922 I21L probably benign Het
Mia3 A G 1: 183,332,830 Y447H probably damaging Het
Mrpl46 A C 7: 78,780,595 N142K probably benign Het
Myo18a C A 11: 77,859,236 probably benign Het
Nup188 A G 2: 30,326,511 T776A possibly damaging Het
Oas1h C A 5: 120,862,665 H113N probably damaging Het
Olfr1505 A T 19: 13,919,453 L144F possibly damaging Het
Olfr771 T A 10: 129,160,376 T203S possibly damaging Het
Olfr830 A G 9: 18,875,917 I197V probably benign Het
Olfr845 C T 9: 19,339,180 T240M probably damaging Het
Orc3 T A 4: 34,572,450 probably benign Het
Osbpl3 T A 6: 50,353,000 L65F probably damaging Het
Papola C A 12: 105,799,653 P4Q probably damaging Het
Pepd A G 7: 34,945,597 N151S probably damaging Het
Plekhm2 A G 4: 141,627,839 L959P probably benign Het
Prpf40a A T 2: 53,190,020 H82Q probably damaging Het
Robo1 C T 16: 72,972,035 T496M probably benign Het
Samd9l T G 6: 3,372,863 Q1466P probably damaging Het
Serpina1a T C 12: 103,854,763 T342A probably benign Het
Serpina3i A G 12: 104,265,211 T36A probably benign Het
Serpinb5 G T 1: 106,872,339 L86F probably damaging Het
Slc35g1 A G 19: 38,402,827 S186G possibly damaging Het
Slco6d1 T A 1: 98,423,174 D126E probably benign Het
Smchd1 A G 17: 71,411,768 probably null Het
Smpdl3a C A 10: 57,811,241 T355K probably damaging Het
Sntg2 A G 12: 30,373,268 probably benign Het
Sox14 T A 9: 99,875,231 M152L probably benign Het
Spats2l G T 1: 57,937,926 A308S possibly damaging Het
Tcf12 T C 9: 71,870,041 probably benign Het
Tcf7l2 T A 19: 55,924,072 C478* probably null Het
Tekt5 A G 16: 10,382,907 L250P probably damaging Het
Tmem132d T G 5: 127,984,264 I425L probably benign Het
Tmem174 T A 13: 98,636,948 I125F probably damaging Het
Trafd1 T G 5: 121,374,016 I404L probably benign Het
Trpm5 G A 7: 143,082,636 P500S possibly damaging Het
Trpm6 T A 19: 18,862,212 N1616K probably benign Het
Vmn1r4 A G 6: 56,956,730 D73G possibly damaging Het
Vmn2r85 T A 10: 130,418,698 I706F probably benign Het
Zc3h14 C G 12: 98,752,848 D157E probably damaging Het
Zfp982 A G 4: 147,512,633 Q149R possibly damaging Het
Other mutations in Ddx10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Ddx10 APN 9 53160026 splice site probably benign
IGL01111:Ddx10 APN 9 53159948 missense possibly damaging 0.73
IGL01773:Ddx10 APN 9 53204130 missense possibly damaging 0.94
IGL01837:Ddx10 APN 9 53229198 missense probably benign 0.16
IGL02036:Ddx10 APN 9 53204183 missense probably benign 0.00
IGL02236:Ddx10 APN 9 53235382 missense probably damaging 1.00
IGL02939:Ddx10 APN 9 53204279 missense possibly damaging 0.63
IGL03294:Ddx10 APN 9 53117152 critical splice donor site probably null
R0279:Ddx10 UTSW 9 53235304 missense probably damaging 1.00
R1439:Ddx10 UTSW 9 53240487 missense probably damaging 1.00
R1501:Ddx10 UTSW 9 53233997 missense possibly damaging 0.85
R1529:Ddx10 UTSW 9 53117199 nonsense probably null
R1548:Ddx10 UTSW 9 53149561 critical splice acceptor site probably null
R1717:Ddx10 UTSW 9 53159953 missense probably benign 0.25
R1720:Ddx10 UTSW 9 53238071 missense probably damaging 1.00
R1781:Ddx10 UTSW 9 53207545 missense probably damaging 1.00
R2005:Ddx10 UTSW 9 53240475 critical splice donor site probably null
R2007:Ddx10 UTSW 9 53213278 missense probably benign 0.06
R2073:Ddx10 UTSW 9 53240505 missense probably benign 0.28
R2075:Ddx10 UTSW 9 53240505 missense probably benign 0.28
R2133:Ddx10 UTSW 9 53149512 missense probably benign 0.13
R4660:Ddx10 UTSW 9 53236398 critical splice donor site probably null
R4668:Ddx10 UTSW 9 53099213 missense possibly damaging 0.55
R4706:Ddx10 UTSW 9 53233931 missense probably damaging 1.00
R5394:Ddx10 UTSW 9 53233857 nonsense probably null
R5655:Ddx10 UTSW 9 53209687 critical splice donor site probably null
R5874:Ddx10 UTSW 9 53229198 missense possibly damaging 0.95
R6341:Ddx10 UTSW 9 53204251 missense probably benign 0.00
R6534:Ddx10 UTSW 9 53223688 missense probably damaging 1.00
R6801:Ddx10 UTSW 9 53247907 nonsense probably null
R6994:Ddx10 UTSW 9 53204111 missense probably damaging 0.99
R7155:Ddx10 UTSW 9 53117288 missense probably benign 0.00
R7380:Ddx10 UTSW 9 53240486 missense probably damaging 1.00
X0019:Ddx10 UTSW 9 53233996 missense probably damaging 1.00
X0063:Ddx10 UTSW 9 53225573 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCCATGACATGAGTAAATG -3'
(R):5'- GGCTAGTGGTGACGGTGAC -3'

Sequencing Primer
(F):5'- TGCTATATACTGGCCAGGAAAAAC -3'
(R):5'- TGACGAAGAACAGGATGAAGAGAC -3'
Posted On2016-02-04