Incidental Mutation 'R4814:Dip2c'
ID369664
Institutional Source Beutler Lab
Gene Symbol Dip2c
Ensembl Gene ENSMUSG00000048264
Gene Namedisco interacting protein 2 homolog C
Synonyms2900024P20Rik
MMRRC Submission 042432-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.645) question?
Stock #R4814 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location9276528-9668928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9536860 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 200 (H200R)
Ref Sequence ENSEMBL: ENSMUSP00000133806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166299] [ENSMUST00000169960] [ENSMUST00000174552]
Predicted Effect probably benign
Transcript: ENSMUST00000166299
AA Change: H200R

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000126827
Gene: ENSMUSG00000048264
AA Change: H200R

DomainStartEndE-ValueType
DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 801 3.6e-23 PFAM
Pfam:AMP-binding 977 1451 1.5e-72 PFAM
low complexity region 1514 1526 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169960
AA Change: H256R

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000131238
Gene: ENSMUSG00000048264
AA Change: H256R

DomainStartEndE-ValueType
DMAP_binding 7 176 3.02e-37 SMART
low complexity region 226 243 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
Pfam:AMP-binding 380 637 5.9e-10 PFAM
SCOP:d1lci__ 675 875 2e-8 SMART
Pfam:AMP-binding 947 1421 1.2e-56 PFAM
low complexity region 1484 1496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174552
AA Change: H200R

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000133806
Gene: ENSMUSG00000048264
AA Change: H200R

DomainStartEndE-ValueType
DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 800 2.7e-20 PFAM
Pfam:AMP-binding 976 1450 1.3e-56 PFAM
low complexity region 1513 1525 N/A INTRINSIC
Meta Mutation Damage Score 0.208 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 family. The protein shares strong similarity with a Drosophila protein which interacts with the transcription factor disco and is expressed in the nervous system. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T G 16: 56,650,753 V587G probably benign Het
Abtb2 A G 2: 103,717,287 D1002G probably benign Het
Acap2 A G 16: 31,108,126 S524P probably benign Het
Acsm1 A T 7: 119,655,464 I385L probably benign Het
Adra1a C G 14: 66,638,032 A152G probably benign Het
Agbl4 A T 4: 111,656,368 Y437F possibly damaging Het
Amt A G 9: 108,299,780 T196A probably benign Het
Apobr G A 7: 126,586,687 V457M probably benign Het
Birc6 A G 17: 74,649,672 K3563E probably damaging Het
Cdadc1 AGACGGA AGA 14: 59,568,991 probably null Het
Chrna9 T C 5: 65,977,149 W448R probably damaging Het
Cyp4a31 A T 4: 115,570,269 D224V probably damaging Het
Ddx10 C A 9: 53,204,105 R643L possibly damaging Het
Dnah8 A T 17: 30,767,924 R3182S probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Egfr T C 11: 16,869,354 C295R probably damaging Het
Garem1 A T 18: 21,148,116 N394K probably damaging Het
Gcat T C 15: 79,031,122 probably null Het
Gckr C T 5: 31,298,300 Q66* probably null Het
Gm26996 A T 6: 130,579,354 noncoding transcript Het
Gm9386 C A 17: 80,938,712 noncoding transcript Het
Gpr6 A T 10: 41,071,262 M108K possibly damaging Het
H2-Q10 A C 17: 35,473,584 probably benign Het
Hpf1 A G 8: 60,893,807 D52G probably damaging Het
Jak2 A G 19: 29,301,977 R989G probably damaging Het
Kat7 A G 11: 95,303,123 probably benign Het
Kcnn3 G T 3: 89,662,724 V615F probably damaging Het
Lgi1 G T 19: 38,300,878 probably null Het
Lrrtm4 A T 6: 80,023,134 T510S possibly damaging Het
Map7d1 A G 4: 126,234,321 probably null Het
Mapt T C 11: 104,298,960 V252A probably benign Het
Mbd4 A T 6: 115,849,299 S223T possibly damaging Het
Meig1 T A 2: 3,411,922 I21L probably benign Het
Mia3 A G 1: 183,332,830 Y447H probably damaging Het
Mrpl46 A C 7: 78,780,595 N142K probably benign Het
Myo18a C A 11: 77,859,236 probably benign Het
Nup188 A G 2: 30,326,511 T776A possibly damaging Het
Oas1h C A 5: 120,862,665 H113N probably damaging Het
Olfr1505 A T 19: 13,919,453 L144F possibly damaging Het
Olfr771 T A 10: 129,160,376 T203S possibly damaging Het
Olfr830 A G 9: 18,875,917 I197V probably benign Het
Olfr845 C T 9: 19,339,180 T240M probably damaging Het
Orc3 T A 4: 34,572,450 probably benign Het
Osbpl3 T A 6: 50,353,000 L65F probably damaging Het
Papola C A 12: 105,799,653 P4Q probably damaging Het
Pepd A G 7: 34,945,597 N151S probably damaging Het
Plekhm2 A G 4: 141,627,839 L959P probably benign Het
Prpf40a A T 2: 53,190,020 H82Q probably damaging Het
Robo1 C T 16: 72,972,035 T496M probably benign Het
Samd9l T G 6: 3,372,863 Q1466P probably damaging Het
Serpina1a T C 12: 103,854,763 T342A probably benign Het
Serpina3i A G 12: 104,265,211 T36A probably benign Het
Serpinb5 G T 1: 106,872,339 L86F probably damaging Het
Slc35g1 A G 19: 38,402,827 S186G possibly damaging Het
Slco6d1 T A 1: 98,423,174 D126E probably benign Het
Smchd1 A G 17: 71,411,768 probably null Het
Smpdl3a C A 10: 57,811,241 T355K probably damaging Het
Sntg2 A G 12: 30,373,268 probably benign Het
Sox14 T A 9: 99,875,231 M152L probably benign Het
Spats2l G T 1: 57,937,926 A308S possibly damaging Het
Tcf12 T C 9: 71,870,041 probably benign Het
Tcf7l2 T A 19: 55,924,072 C478* probably null Het
Tekt5 A G 16: 10,382,907 L250P probably damaging Het
Tmem132d T G 5: 127,984,264 I425L probably benign Het
Tmem174 T A 13: 98,636,948 I125F probably damaging Het
Trafd1 T G 5: 121,374,016 I404L probably benign Het
Trpm5 G A 7: 143,082,636 P500S possibly damaging Het
Trpm6 T A 19: 18,862,212 N1616K probably benign Het
Vmn1r4 A G 6: 56,956,730 D73G possibly damaging Het
Vmn2r85 T A 10: 130,418,698 I706F probably benign Het
Zc3h14 C G 12: 98,752,848 D157E probably damaging Het
Zfp982 A G 4: 147,512,633 Q149R possibly damaging Het
Other mutations in Dip2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Dip2c APN 13 9493108 missense probably damaging 0.97
IGL00426:Dip2c APN 13 9606515 missense probably damaging 1.00
IGL00503:Dip2c APN 13 9567898 missense probably damaging 1.00
IGL00586:Dip2c APN 13 9610755 missense probably damaging 1.00
IGL01306:Dip2c APN 13 9575143 missense possibly damaging 0.72
IGL01580:Dip2c APN 13 9637088 splice site probably null
IGL01985:Dip2c APN 13 9553267 splice site probably benign
IGL02060:Dip2c APN 13 9622630 missense probably damaging 0.98
IGL02122:Dip2c APN 13 9506659 missense possibly damaging 0.48
IGL02170:Dip2c APN 13 9606335 missense probably benign 0.03
IGL02211:Dip2c APN 13 9610847 missense probably damaging 1.00
IGL02755:Dip2c APN 13 9550320 critical splice donor site probably null
IGL02836:Dip2c APN 13 9610790 missense probably damaging 0.98
IGL02935:Dip2c APN 13 9662146 missense probably damaging 1.00
IGL03032:Dip2c APN 13 9551778 missense probably damaging 1.00
ANU23:Dip2c UTSW 13 9575143 missense possibly damaging 0.72
P0038:Dip2c UTSW 13 9646982 missense probably damaging 1.00
R0009:Dip2c UTSW 13 9621903 missense probably damaging 1.00
R0268:Dip2c UTSW 13 9637150 missense probably damaging 1.00
R0271:Dip2c UTSW 13 9615775 missense probably damaging 1.00
R0306:Dip2c UTSW 13 9604599 missense probably benign 0.09
R0415:Dip2c UTSW 13 9568289 splice site probably benign
R0519:Dip2c UTSW 13 9563208 missense probably damaging 1.00
R0557:Dip2c UTSW 13 9553459 missense possibly damaging 0.81
R0964:Dip2c UTSW 13 9568663 missense probably benign 0.43
R0973:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R0973:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R0974:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R1101:Dip2c UTSW 13 9634744 missense probably damaging 1.00
R1171:Dip2c UTSW 13 9493126 missense possibly damaging 0.89
R1403:Dip2c UTSW 13 9553264 splice site probably null
R1403:Dip2c UTSW 13 9553264 splice site probably null
R1432:Dip2c UTSW 13 9553304 missense probably damaging 0.99
R1481:Dip2c UTSW 13 9551866 critical splice donor site probably null
R1588:Dip2c UTSW 13 9665864 missense probably damaging 1.00
R1721:Dip2c UTSW 13 9659368 missense probably damaging 1.00
R1726:Dip2c UTSW 13 9575428 missense probably damaging 1.00
R1867:Dip2c UTSW 13 9621949 missense possibly damaging 0.55
R1909:Dip2c UTSW 13 9533350 missense probably benign 0.00
R2013:Dip2c UTSW 13 9567846 nonsense probably null
R2022:Dip2c UTSW 13 9551800 missense probably damaging 1.00
R2517:Dip2c UTSW 13 9609005 missense probably damaging 1.00
R3746:Dip2c UTSW 13 9601473 missense probably damaging 1.00
R3794:Dip2c UTSW 13 9604561 missense probably damaging 0.99
R3884:Dip2c UTSW 13 9551858 missense probably damaging 1.00
R4019:Dip2c UTSW 13 9614365 missense probably damaging 0.99
R4110:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4111:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4113:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4256:Dip2c UTSW 13 9609056 missense probably damaging 1.00
R4300:Dip2c UTSW 13 9610711 missense probably damaging 1.00
R4494:Dip2c UTSW 13 9571062 missense possibly damaging 0.64
R4739:Dip2c UTSW 13 9533339 missense probably damaging 0.98
R4812:Dip2c UTSW 13 9637130 nonsense probably null
R4816:Dip2c UTSW 13 9575150 missense probably benign 0.37
R4828:Dip2c UTSW 13 9560679 missense probably damaging 1.00
R4915:Dip2c UTSW 13 9621869 splice site probably null
R4917:Dip2c UTSW 13 9621869 splice site probably null
R4932:Dip2c UTSW 13 9623972 missense probably damaging 0.99
R4993:Dip2c UTSW 13 9575223 nonsense probably null
R5043:Dip2c UTSW 13 9551827 missense possibly damaging 0.80
R5349:Dip2c UTSW 13 9622653 missense probably damaging 1.00
R5744:Dip2c UTSW 13 9568405 missense probably damaging 1.00
R5840:Dip2c UTSW 13 9506676 missense possibly damaging 0.68
R6110:Dip2c UTSW 13 9623766 missense probably damaging 1.00
R6160:Dip2c UTSW 13 9533254 missense probably benign 0.01
R6161:Dip2c UTSW 13 9647007 missense probably damaging 1.00
R6477:Dip2c UTSW 13 9623760 missense probably damaging 1.00
R6522:Dip2c UTSW 13 9575228 critical splice donor site probably null
R6603:Dip2c UTSW 13 9654588 splice site probably null
R6658:Dip2c UTSW 13 9493177 critical splice donor site probably null
R6672:Dip2c UTSW 13 9567830 critical splice acceptor site probably null
R6697:Dip2c UTSW 13 9621913 missense probably damaging 1.00
R6991:Dip2c UTSW 13 9551860 nonsense probably null
R6991:Dip2c UTSW 13 9634832 missense probably damaging 1.00
R7018:Dip2c UTSW 13 9659278 missense probably damaging 1.00
R7053:Dip2c UTSW 13 9610704 missense probably damaging 1.00
R7102:Dip2c UTSW 13 9604536 missense probably benign 0.01
R7171:Dip2c UTSW 13 9506648 missense probably benign 0.34
R7371:Dip2c UTSW 13 9592749 missense probably benign 0.02
R7395:Dip2c UTSW 13 9614377 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTTGAAAACAGATACCTCTTCCG -3'
(R):5'- TGAAGTCCAGTGCAGCAACC -3'

Sequencing Primer
(F):5'- GATACCTCTTCCGGTTCAGAAGATG -3'
(R):5'- GTGCAGCAACCCAAAATCTG -3'
Posted On2016-02-04