Incidental Mutation 'R4814:Dnase1l1'
ID 369685
Institutional Source Beutler Lab
Gene Symbol Dnase1l1
Ensembl Gene ENSMUSG00000019088
Gene Name deoxyribonuclease 1-like 1
Synonyms 2310005K03Rik, G4.8, Dnase1ll, Dnl1ll
MMRRC Submission 042432-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.067) question?
Stock # R4814 (G1)
Quality Score 222
Status Validated
Chromosome X
Chromosomal Location 73316823-73325939 bp(-) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 73320644 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008826] [ENSMUST00000019232] [ENSMUST00000074085] [ENSMUST00000075821] [ENSMUST00000114189] [ENSMUST00000119361] [ENSMUST00000151702] [ENSMUST00000135690]
AlphaFold Q9D7J6
Predicted Effect probably benign
Transcript: ENSMUST00000008826
SMART Domains Protein: ENSMUSP00000008826
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 167 1.1e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000019232
SMART Domains Protein: ENSMUSP00000019232
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
DNaseIc 21 289 3.93e-149 SMART
low complexity region 301 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074085
SMART Domains Protein: ENSMUSP00000082055
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 167 1.1e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000075821
SMART Domains Protein: ENSMUSP00000075218
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
DNaseIc 21 289 3.93e-149 SMART
low complexity region 301 313 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083047
Predicted Effect probably null
Transcript: ENSMUST00000114189
SMART Domains Protein: ENSMUSP00000109827
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
Blast:DNaseIc 21 70 5e-22 BLAST
SCOP:d2dnja_ 39 79 2e-4 SMART
low complexity region 91 103 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119361
SMART Domains Protein: ENSMUSP00000113515
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
Blast:DNaseIc 21 64 2e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125775
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142142
Predicted Effect probably benign
Transcript: ENSMUST00000151702
SMART Domains Protein: ENSMUSP00000115919
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 167 1.5e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135690
SMART Domains Protein: ENSMUSP00000119500
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 150 1.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184075
Meta Mutation Damage Score 0.9711 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a deoxyribonuclease protein that shows high sequence similarity to DNase I. The encoded protein is localized to the endoplasmic reticulum and modified by N-linked glycosylation. Alternate transcriptional splice variants encoding the same protein have been observed. [provided by RefSeq, Jan 2015]
PHENOTYPE: Female mice homozygous for an inactivating mutation of this gene exhibit poor motor coordination on the rotarod even on days 4 and 5 of a 5-day test. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T G 16: 56,471,116 (GRCm39) V587G probably benign Het
Abtb2 A G 2: 103,547,632 (GRCm39) D1002G probably benign Het
Acap2 A G 16: 30,926,944 (GRCm39) S524P probably benign Het
Acsm1 A T 7: 119,254,687 (GRCm39) I385L probably benign Het
Adra1a C G 14: 66,875,481 (GRCm39) A152G probably benign Het
Agbl4 A T 4: 111,513,565 (GRCm39) Y437F possibly damaging Het
Amt A G 9: 108,176,979 (GRCm39) T196A probably benign Het
Apobr G A 7: 126,185,859 (GRCm39) V457M probably benign Het
Birc6 A G 17: 74,956,667 (GRCm39) K3563E probably damaging Het
Cdadc1 AGACGGA AGA 14: 59,806,440 (GRCm39) probably null Het
Chrna9 T C 5: 66,134,492 (GRCm39) W448R probably damaging Het
Cyp4a31 A T 4: 115,427,466 (GRCm39) D224V probably damaging Het
Ddx10 C A 9: 53,115,405 (GRCm39) R643L possibly damaging Het
Dip2c A G 13: 9,586,896 (GRCm39) H200R probably benign Het
Dnah8 A T 17: 30,986,898 (GRCm39) R3182S probably damaging Het
Egfr T C 11: 16,819,354 (GRCm39) C295R probably damaging Het
Garem1 A T 18: 21,281,173 (GRCm39) N394K probably damaging Het
Gcat T C 15: 78,915,322 (GRCm39) probably null Het
Gckr C T 5: 31,455,644 (GRCm39) Q66* probably null Het
Gm26996 A T 6: 130,556,317 (GRCm39) noncoding transcript Het
Gm9386 C A 17: 81,246,141 (GRCm39) noncoding transcript Het
Gpr6 A T 10: 40,947,258 (GRCm39) M108K possibly damaging Het
H2-Q10 A C 17: 35,784,481 (GRCm39) probably benign Het
Hpf1 A G 8: 61,346,841 (GRCm39) D52G probably damaging Het
Jak2 A G 19: 29,279,377 (GRCm39) R989G probably damaging Het
Kat7 A G 11: 95,193,949 (GRCm39) probably benign Het
Kcnn3 G T 3: 89,570,031 (GRCm39) V615F probably damaging Het
Lgi1 G T 19: 38,289,326 (GRCm39) probably null Het
Lrrtm4 A T 6: 80,000,117 (GRCm39) T510S possibly damaging Het
Map7d1 A G 4: 126,128,114 (GRCm39) probably null Het
Mapt T C 11: 104,189,786 (GRCm39) V252A probably benign Het
Mbd4 A T 6: 115,826,260 (GRCm39) S223T possibly damaging Het
Meig1 T A 2: 3,412,959 (GRCm39) I21L probably benign Het
Mia3 A G 1: 183,113,684 (GRCm39) Y447H probably damaging Het
Mrpl46 A C 7: 78,430,343 (GRCm39) N142K probably benign Het
Myo18a C A 11: 77,750,062 (GRCm39) probably benign Het
Nup188 A G 2: 30,216,523 (GRCm39) T776A possibly damaging Het
Oas1h C A 5: 121,000,728 (GRCm39) H113N probably damaging Het
Or6c202 T A 10: 128,996,245 (GRCm39) T203S possibly damaging Het
Or7g18 A G 9: 18,787,213 (GRCm39) I197V probably benign Het
Or7g27 C T 9: 19,250,476 (GRCm39) T240M probably damaging Het
Or9i1b A T 19: 13,896,817 (GRCm39) L144F possibly damaging Het
Orc3 T A 4: 34,572,450 (GRCm39) probably benign Het
Osbpl3 T A 6: 50,329,980 (GRCm39) L65F probably damaging Het
Papola C A 12: 105,765,912 (GRCm39) P4Q probably damaging Het
Pepd A G 7: 34,645,022 (GRCm39) N151S probably damaging Het
Plekhm2 A G 4: 141,355,150 (GRCm39) L959P probably benign Het
Prpf40a A T 2: 53,080,032 (GRCm39) H82Q probably damaging Het
Robo1 C T 16: 72,768,923 (GRCm39) T496M probably benign Het
Samd9l T G 6: 3,372,863 (GRCm39) Q1466P probably damaging Het
Serpina1a T C 12: 103,821,022 (GRCm39) T342A probably benign Het
Serpina3i A G 12: 104,231,470 (GRCm39) T36A probably benign Het
Serpinb5 G T 1: 106,800,069 (GRCm39) L86F probably damaging Het
Slc35g1 A G 19: 38,391,275 (GRCm39) S186G possibly damaging Het
Slco6d1 T A 1: 98,350,899 (GRCm39) D126E probably benign Het
Smchd1 A G 17: 71,718,763 (GRCm39) probably null Het
Smpdl3a C A 10: 57,687,337 (GRCm39) T355K probably damaging Het
Sntg2 A G 12: 30,423,267 (GRCm39) probably benign Het
Sox14 T A 9: 99,757,284 (GRCm39) M152L probably benign Het
Spats2l G T 1: 57,977,085 (GRCm39) A308S possibly damaging Het
Tcf12 T C 9: 71,777,323 (GRCm39) probably benign Het
Tcf7l2 T A 19: 55,912,504 (GRCm39) C478* probably null Het
Tekt5 A G 16: 10,200,771 (GRCm39) L250P probably damaging Het
Tmem132d T G 5: 128,061,328 (GRCm39) I425L probably benign Het
Tmem174 T A 13: 98,773,456 (GRCm39) I125F probably damaging Het
Trafd1 T G 5: 121,512,079 (GRCm39) I404L probably benign Het
Trpm5 G A 7: 142,636,373 (GRCm39) P500S possibly damaging Het
Trpm6 T A 19: 18,839,576 (GRCm39) N1616K probably benign Het
Vmn1r4 A G 6: 56,933,715 (GRCm39) D73G possibly damaging Het
Vmn2r85 T A 10: 130,254,567 (GRCm39) I706F probably benign Het
Zc3h14 C G 12: 98,719,107 (GRCm39) D157E probably damaging Het
Zfp982 A G 4: 147,597,090 (GRCm39) Q149R possibly damaging Het
Other mutations in Dnase1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4691:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4752:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4753:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4815:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4846:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4861:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4862:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4872:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4873:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4875:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4978:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4979:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4980:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4981:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4982:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4983:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5039:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5084:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5085:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5086:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5087:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5106:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5107:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5108:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5109:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5137:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5171:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5266:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5296:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5330:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5417:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5418:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5419:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5448:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5450:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5466:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5467:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6126:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6128:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6129:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6130:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6232:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6233:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6234:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6242:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6305:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6306:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6329:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6343:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6344:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6396:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6397:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6449:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6450:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6585:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6586:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6646:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6679:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6681:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6845:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6847:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R8526:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGATTGGTACCAGAGTGGCTG -3'
(R):5'- CTTTGGAGGGTTCCTGATGCAC -3'

Sequencing Primer
(F):5'- TACCAGAGTGGCTGCAGAC -3'
(R):5'- GGTTCCTGATGCACACATAGCAATG -3'
Posted On 2016-02-04