Incidental Mutation 'R4815:Zc3h14'
ID369730
Institutional Source Beutler Lab
Gene Symbol Zc3h14
Ensembl Gene ENSMUSG00000021012
Gene Namezinc finger CCCH type containing 14
Synonyms1700016A15Rik, 1010001P15Rik, 2700069A02Rik
MMRRC Submission 042433-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4815 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location98746964-98787753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 98752848 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 157 (D157E)
Ref Sequence ENSEMBL: ENSMUSP00000152816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057000] [ENSMUST00000110104] [ENSMUST00000110105] [ENSMUST00000223083]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057000
AA Change: D50E

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000055879
Gene: ENSMUSG00000021012
AA Change: D50E

DomainStartEndE-ValueType
low complexity region 298 306 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ZnF_C3H1 440 463 7.16e-1 SMART
ZnF_C3H1 465 484 5.27e1 SMART
ZnF_C3H1 520 542 5.55e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110104
AA Change: D50E

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105731
Gene: ENSMUSG00000021012
AA Change: D50E

DomainStartEndE-ValueType
low complexity region 298 306 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ZnF_C3H1 465 488 7.16e-1 SMART
ZnF_C3H1 490 509 5.27e1 SMART
ZnF_C3H1 545 567 5.55e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110105
AA Change: D50E

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105732
Gene: ENSMUSG00000021012
AA Change: D50E

DomainStartEndE-ValueType
low complexity region 298 306 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ZnF_C3H1 596 619 7.16e-1 SMART
ZnF_C3H1 621 640 5.27e1 SMART
ZnF_C3H1 676 698 5.55e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221558
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222461
Predicted Effect probably damaging
Transcript: ENSMUST00000223083
AA Change: D157E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Meta Mutation Damage Score 0.0644 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 96% (76/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a poly(A)-binding protein that can affect gene expression and poly(A) tail length. The encoded protein may influence mRNA stability, nuclear export, and translation. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous knockout results in impaired spatial working memory, enlarged anterior lateral ventricles in the brain, small testes and reduced litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk2 A T 18: 65,349,955 N327K probably damaging Het
Ank2 T C 3: 126,936,761 T675A probably benign Het
Arap3 T C 18: 37,973,243 T1516A probably benign Het
Asb18 A T 1: 90,014,425 N51K probably damaging Het
BC003331 A G 1: 150,374,846 C294R probably damaging Het
C7 A G 15: 5,059,405 V18A probably benign Het
Caap1 A G 4: 94,501,260 V279A probably benign Het
Cacnb2 A G 2: 14,874,780 D21G probably damaging Het
Ccdc171 T C 4: 83,795,221 S1166P probably damaging Het
Chgb A T 2: 132,793,299 H387L probably benign Het
Chp2 G A 7: 122,220,900 R91Q probably damaging Het
Chuk C A 19: 44,077,247 G703* probably null Het
Clmn T C 12: 104,785,566 D210G probably damaging Het
Cyp4f18 A G 8: 71,995,995 V270A possibly damaging Het
Dgcr2 A G 16: 17,858,619 probably benign Het
Diaph1 A T 18: 37,895,203 V411D unknown Het
Dkk2 C T 3: 132,173,785 A75V probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dnase2a T C 8: 84,909,877 V187A probably benign Het
Dusp19 A G 2: 80,630,945 M193V probably benign Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Gm37596 C T 3: 93,692,286 V259M probably benign Het
Golgb1 A T 16: 36,913,115 Q908L possibly damaging Het
Hsp90aa1 T C 12: 110,695,226 M119V possibly damaging Het
Ice2 C T 9: 69,407,118 R50C probably damaging Het
Ifi208 A T 1: 173,682,837 E186V probably damaging Het
Ift122 A G 6: 115,881,556 K166E possibly damaging Het
Jcad T A 18: 4,675,223 L995Q possibly damaging Het
Kcnc4 A T 3: 107,458,266 C209S probably benign Het
Kmt2a G A 9: 44,821,256 probably benign Het
Lrriq1 T A 10: 103,144,878 L1465F probably benign Het
Map3k7 C A 4: 31,988,592 T247N probably damaging Het
Mctp2 T G 7: 72,259,349 Q72P possibly damaging Het
Miga1 T C 3: 152,290,806 Y335C probably benign Het
Ms4a14 A T 19: 11,314,277 N19K probably benign Het
Mylk G A 16: 34,894,925 R541Q probably damaging Het
Nav3 T C 10: 109,823,552 T735A probably benign Het
Nlgn1 T A 3: 25,436,030 H511L probably damaging Het
Nlrp4a A T 7: 26,450,808 E613D probably benign Het
Nuf2 A G 1: 169,510,468 S247P probably damaging Het
Ocstamp A G 2: 165,398,182 V28A probably benign Het
Odf2 A C 2: 29,902,240 E155D possibly damaging Het
Olfr285 T C 15: 98,312,680 N290S probably damaging Het
Olfr695 G A 7: 106,874,237 P3S probably benign Het
Otud7a T C 7: 63,729,910 probably null Het
Pacsin2 A T 15: 83,385,059 D11E probably damaging Het
Pcdhga5 G A 18: 37,695,194 V232I probably damaging Het
Plcb3 A G 19: 6,962,984 I439T possibly damaging Het
Rag1 A G 2: 101,643,516 V427A probably damaging Het
Ranbp10 A T 8: 105,826,125 C128* probably null Het
Rbm8a2 A G 1: 175,978,458 V151A probably damaging Het
S100pbp A G 4: 129,150,933 probably benign Het
Serpinb5 G T 1: 106,872,339 L86F probably damaging Het
Sgo2b T C 8: 63,931,414 I183V probably benign Het
Slc25a25 A T 2: 32,420,410 D112E probably damaging Het
Slc30a5 C T 13: 100,813,710 V103I probably damaging Het
Slc9a2 A T 1: 40,718,849 I183F probably benign Het
Srrm4 T A 5: 116,475,190 K141N unknown Het
Tbc1d20 T C 2: 152,311,989 probably benign Het
Tep1 A G 14: 50,841,302 L1498P probably damaging Het
Tgfbi T C 13: 56,632,120 M494T probably benign Het
Tox A G 4: 6,823,033 S95P probably benign Het
Tpr G A 1: 150,398,608 V163I probably benign Het
Trpm7 A G 2: 126,858,492 S2P probably damaging Het
Ttn A G 2: 76,716,085 M32328T probably damaging Het
Vps39 A T 2: 120,338,559 N289K probably benign Het
Xdh C T 17: 73,906,215 A847T probably damaging Het
Xndc1 G A 7: 102,073,316 G63R probably null Het
Ythdc2 A G 18: 44,885,240 S1330G probably benign Het
Zc3h7b A T 15: 81,793,663 K949N probably damaging Het
Zp3r A T 1: 130,598,912 Y185N probably damaging Het
Other mutations in Zc3h14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Zc3h14 APN 12 98747524 critical splice donor site probably null
IGL00946:Zc3h14 APN 12 98759883 splice site probably benign
IGL00969:Zc3h14 APN 12 98758843 missense probably benign 0.00
IGL01626:Zc3h14 APN 12 98779186 missense possibly damaging 0.72
IGL01891:Zc3h14 APN 12 98758947 unclassified probably benign
IGL02119:Zc3h14 APN 12 98763895 missense probably benign 0.00
IGL02484:Zc3h14 APN 12 98774301 missense probably benign 0.14
IGL02744:Zc3h14 APN 12 98784975 missense possibly damaging 0.67
IGL02894:Zc3h14 APN 12 98758943 critical splice donor site probably null
R0408:Zc3h14 UTSW 12 98763823 missense probably damaging 1.00
R0739:Zc3h14 UTSW 12 98757201 missense probably damaging 0.99
R0865:Zc3h14 UTSW 12 98779269 critical splice donor site probably null
R0926:Zc3h14 UTSW 12 98758590 missense possibly damaging 0.94
R1530:Zc3h14 UTSW 12 98785003 missense probably damaging 1.00
R1735:Zc3h14 UTSW 12 98758580 missense probably damaging 1.00
R1743:Zc3h14 UTSW 12 98779189 missense probably benign 0.04
R1848:Zc3h14 UTSW 12 98752832 missense possibly damaging 0.89
R1851:Zc3h14 UTSW 12 98760354 nonsense probably null
R1978:Zc3h14 UTSW 12 98763922 missense probably damaging 0.97
R2011:Zc3h14 UTSW 12 98780268 missense possibly damaging 0.76
R2198:Zc3h14 UTSW 12 98752809 missense probably damaging 1.00
R2198:Zc3h14 UTSW 12 98752810 missense possibly damaging 0.94
R2263:Zc3h14 UTSW 12 98758514 missense probably benign 0.32
R3762:Zc3h14 UTSW 12 98758643 missense probably damaging 1.00
R4210:Zc3h14 UTSW 12 98785399 missense probably damaging 1.00
R4353:Zc3h14 UTSW 12 98763960 missense possibly damaging 0.70
R4360:Zc3h14 UTSW 12 98780197 missense probably benign 0.09
R4814:Zc3h14 UTSW 12 98752848 missense probably damaging 1.00
R4817:Zc3h14 UTSW 12 98752848 missense probably damaging 1.00
R4947:Zc3h14 UTSW 12 98759824 missense probably benign
R5077:Zc3h14 UTSW 12 98757206 critical splice donor site probably null
R5431:Zc3h14 UTSW 12 98780065 missense possibly damaging 0.94
R5783:Zc3h14 UTSW 12 98757175 missense probably damaging 0.99
R5850:Zc3h14 UTSW 12 98779155 missense probably damaging 0.97
R6034:Zc3h14 UTSW 12 98771373 missense probably benign 0.01
R6034:Zc3h14 UTSW 12 98771373 missense probably benign 0.01
R6291:Zc3h14 UTSW 12 98759828 missense probably damaging 1.00
R6338:Zc3h14 UTSW 12 98758590 missense possibly damaging 0.94
R6595:Zc3h14 UTSW 12 98757026 missense probably damaging 0.98
R6737:Zc3h14 UTSW 12 98785046 missense probably damaging 1.00
R6932:Zc3h14 UTSW 12 98771077 intron probably benign
R7074:Zc3h14 UTSW 12 98758600 missense possibly damaging 0.96
R7204:Zc3h14 UTSW 12 98771356 missense probably damaging 1.00
R7237:Zc3h14 UTSW 12 98780149 missense probably benign 0.34
R7267:Zc3h14 UTSW 12 98785729 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGAGCGTTCTTGTCTAGC -3'
(R):5'- TTACAGATGAAGAAACCTCCAGAG -3'

Sequencing Primer
(F):5'- TCTAGCCTCTGTTAGAAGGAGG -3'
(R):5'- TCCAGAGGCTATGCTTTACAG -3'
Posted On2016-02-04