Incidental Mutation 'R4816:0610010F05Rik'
List |< first << previous [record 42 of 386652] next >> last >|
ID369816
Institutional Source Beutler Lab
Gene Symbol 0610010F05Rik
Ensembl Gene ENSMUSG00000042208
Gene NameRIKEN cDNA 0610010F05 gene
Synonyms
MMRRC Submission
Accession Numbers
Stock #R4816 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location23564961-23633631 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 23615243 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 248 (I248S)
Ref Sequence ENSEMBL: ENSMUSP00000121553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043356] [ENSMUST00000109532] [ENSMUST00000141353] [ENSMUST00000155903] [ENSMUST00000180260]
Predicted Effect probably benign
Transcript: ENSMUST00000043356
AA Change: I248S

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000044265
Gene: ENSMUSG00000042208
AA Change: I248S

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 5.1e-107 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109532
AA Change: I248S

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105158
Gene: ENSMUSG00000042208
AA Change: I248S

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 5.1e-107 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141353
AA Change: I102S

PolyPhen 2 Score 0.327 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000121553
Gene: ENSMUSG00000042208
AA Change: I102S

DomainStartEndE-ValueType
Pfam:DUF3342 1 189 7.1e-75 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000155903
AA Change: I248S

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000137799
Gene: ENSMUSG00000042208
AA Change: I248S

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 1e-106 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180260
AA Change: I248S

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000136118
Gene: ENSMUSG00000042208
AA Change: I248S

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 4.5e-107 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 97% (113/116)
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700060E02Rik A G 14: 19,822,576 F59S probably benign Het
8030462N17Rik A T 18: 77,653,299 probably null Het
Abcc8 C A 7: 46,104,707 A1562S probably benign Het
Adam30 C A 3: 98,162,745 D631E possibly damaging Het
Adgrv1 T C 13: 81,528,674 T2013A probably damaging Het
Als2cr12 G A 1: 58,670,408 A196V probably benign Het
Ankle1 C T 8: 71,407,310 R262C noncoding transcript Het
Baiap3 T A 17: 25,247,295 probably null Het
C1qbp A G 11: 70,982,364 V215A noncoding transcript Het
C2cd3 C A 7: 100,391,019 T265K probably benign Het
Cacna1s T A 1: 136,115,269 I1597K possibly damaging Het
Cdadc1 AGACGGA AGA 14: 59,568,991 probably null Het
Cdcp2 A G 4: 107,106,772 Y273C probably damaging Het
Cdh23 A C 10: 60,409,077 V1013G possibly damaging Het
Celf3 T A 3: 94,479,222 I39N probably damaging Het
Cep152 A C 2: 125,563,754 S1619R probably damaging Het
Cfap36 A G 11: 29,245,108 I42T probably damaging Het
Cfap61 G T 2: 146,143,100 V955L probably damaging Het
Chd8 G A 14: 52,215,182 T68I noncoding transcript Het
Cit G A 5: 115,908,691 D388N probably damaging Het
Clca3a2 T C 3: 144,810,852 M328V probably benign Het
Cntn4 A T 6: 106,550,497 I447L probably benign Het
Csmd3 T C 15: 47,857,934 T1538A possibly damaging Het
Cstf1 A G 2: 172,372,985 K9E probably damaging Het
Dip2c T A 13: 9,575,150 M560K probably benign Het
Dsg1a A T 18: 20,333,722 T550S probably benign Het
Dtnb A G 12: 3,749,505 E460G probably damaging Het
Dus1l GAGGTAAG GAG 11: 120,789,758 probably null Het
Eftud1 T A 7: 82,671,719 V120E probably damaging Het
Fbxl13 T C 5: 21,484,003 Y769C probably benign Het
Fcho2 T C 13: 98,806,366 Y22C probably damaging Het
Gbp3 T C 3: 142,567,574 V294A probably damaging Het
Gls A G 1: 52,199,945 F180L noncoding transcript Het
Gltscr1 T C 7: 15,988,906 T229A possibly damaging Het
Gm15130 A T 2: 111,135,369 probably null Het
Gm6185 A T 1: 161,213,158 D733V noncoding transcript Het
Gpr171 T A 3: 59,098,096 H86L probably damaging Het
Gpr179 T C 11: 97,339,248 T694A probably damaging Het
H2-Aa A T 17: 34,283,820 V124E probably damaging Het
H2-M5 A G 17: 36,989,417 S41P noncoding transcript Het
Hist1h2bl A G 13: 21,715,965 M60T probably benign Het
Hmha1 T C 10: 80,026,502 *329Q noncoding transcript Het
Igf2r A T 17: 12,684,097 N2355K probably damaging Het
Il9r A C 11: 32,192,654 S295A possibly damaging Het
Ipo9 T C 1: 135,406,550 T313A probably benign Het
Kalrn C T 16: 34,514,019 A33T noncoding transcript Het
Lama3 G A 18: 12,477,604 V1175M possibly damaging Het
Lhpp T A 7: 132,670,375 C255* probably null Het
Lipe A G 7: 25,380,143 S1013P probably damaging Het
Lrrc25 C T 8: 70,618,076 T169I probably benign Het
Lrrc39 T C 3: 116,568,866 probably null Het
Lrrd1 T A 5: 3,851,126 L477* probably null Het
Lrriq4 A G 3: 30,660,047 I515V possibly damaging Het
Magel2 A G 7: 62,381,092 Y1248C unknown Het
Maml1 G T 11: 50,258,335 N859K possibly damaging Het
Mdm1 A T 10: 118,146,877 H139L probably benign Het
Mef2d C T 3: 88,168,090 P420S possibly damaging Het
Mgat4b A G 11: 50,211,021 K38E probably benign Het
Mtmr4 T C 11: 87,604,097 V405A probably damaging Het
Naip5 G A 13: 100,219,681 S1142F probably benign Het
Naip5 G A 13: 100,219,687 T1140M probably benign Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Nfe2l3 T C 6: 51,456,624 S239P probably damaging Het
Nlrp3 A G 11: 59,548,301 I235V probably benign Het
Nyap2 T A 1: 81,241,313 L318Q probably damaging Het
Nynrin G A 14: 55,872,001 V1522M probably damaging Het
Olfr1016 A T 2: 85,800,047 N74K probably benign Het
Olfr1461 A G 19: 13,165,124 I37V probably benign Het
Olfr659 C T 7: 104,670,735 P11L probably benign Het
Olfr810 T C 10: 129,791,439 D50G probably damaging Het
Olfr875 T A 9: 37,773,430 M257K possibly damaging Het
Oog3 A G 4: 144,159,161 L289P probably damaging Het
Pax6 T C 2: 105,683,784 F417S noncoding transcript Het
Pbrm1 G A 14: 31,110,448 R1441K probably benign Het
Pcdha9 C T 18: 36,999,458 R527W probably damaging Het
Pcdhb17 T C 18: 37,487,397 S747P probably benign Het
Pcnxl3 A C 19: 5,687,995 probably null Het
Pds5a A T 5: 65,651,289 V413E probably damaging Het
Phpt1 G T 2: 25,574,320 P109Q noncoding transcript Het
Phykpl A G 11: 51,592,953 E220G probably benign Homo
Pias2 T C 18: 77,105,891 probably null Het
Pkhd1 T A 1: 20,199,415 I3302L probably damaging Het
Poli A G 18: 70,522,751 L304P probably damaging Het
Ppm1h T A 10: 122,679,379 I65N possibly damaging Het
Ptpn14 T C 1: 189,856,800 L954P probably damaging Het
Pxk T G 14: 8,136,893 M138R probably damaging Het
Rasl11b G T 5: 74,198,397 D188Y probably damaging Het
Ric3 G A 7: 109,057,851 T103I noncoding transcript Het
Ric8 C T 7: 140,861,939 H535Y noncoding transcript Het
Rxfp2 T C 5: 150,052,898 S305P noncoding transcript Het
Serpinb5 G T 1: 106,872,339 L86F probably damaging Het
Setdb2 G A 14: 59,413,646 T412I probably benign Het
Shank2 C A 7: 144,052,306 N75K probably damaging Het
Shank3 T A 15: 89,543,115 I791N probably damaging Het
Slc25a13 T A 6: 6,114,274 M213L possibly damaging Het
Slc25a21 T C 12: 56,713,838 Y298C probably damaging Het
Slc34a2 A G 5: 53,069,020 N495S probably damaging Het
Smc2 A G 4: 52,451,231 T292A probably benign Het
Spag9 T C 11: 94,048,599 I317T noncoding transcript Het
Tas2r113 C T 6: 132,893,782 P258S probably benign Het
Tbkbp1 T C 11: 97,138,741 S530G probably benign Het
Tenm2 A G 11: 36,027,290 V1881A probably damaging Het
Tm9sf1 C T 14: 55,641,149 R262Q possibly damaging Het
Tmcc3 G T 10: 94,578,784 G131V probably damaging Het
Trim38 A T 13: 23,788,281 E195V probably damaging Het
Try5 T C 6: 41,313,415 Y45C probably benign Het
Umad1 A C 6: 8,457,462 H125P unknown Het
Vmn2r105 T C 17: 20,208,691 I708V probably benign Het
Zc3h12d A T 10: 7,867,947 S494C probably damaging Het
Zeb2 A G 2: 44,997,768 S382P probably damaging Het
Zfc3h1 A G 10: 115,415,694 S1304G probably benign Het
Zfp287 G T 11: 62,714,248 T611K probably damaging Het
Zfp534 G A 4: 147,674,286 T642I possibly damaging Het
Other mutations in 0610010F05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:0610010F05Rik APN 11 23595434 missense probably damaging 1.00
IGL01444:0610010F05Rik APN 11 23620225 splice donor site probably benign 0.00
IGL01522:0610010F05Rik APN 11 23582865 critical splice donor site probably null
IGL01819:0610010F05Rik APN 11 23584561 missense probably damaging 1.00
IGL02470:0610010F05Rik APN 11 23615222 missense probably damaging 1.00
IGL03046:0610010F05Rik UTSW 11 23615150 missense possibly damaging 0.77
R0139:0610010F05Rik UTSW 11 23620214 splice donor site probably benign
R0334:0610010F05Rik UTSW 11 23617129 splice donor site probably benign
R0646:0610010F05Rik UTSW 11 23575491 missense probably damaging 0.99
R1078:0610010F05Rik UTSW 11 23611762 missense possibly damaging 0.64
R1263:0610010F05Rik UTSW 11 23620278 nonsense probably null
R1353:0610010F05Rik UTSW 11 23620217 splice donor site probably benign
R1471:0610010F05Rik UTSW 11 23615222 missense probably damaging 1.00
R1568:0610010F05Rik UTSW 11 23589971 missense possibly damaging 0.90
R2163:0610010F05Rik UTSW 11 23576826 splice acceptor site probably benign
R2318:0610010F05Rik UTSW 11 23588701 missense probably damaging 1.00
R2426:0610010F05Rik UTSW 11 23576801 missense probably damaging 1.00
R4373:0610010F05Rik UTSW 11 23615265 unclassified probably null
R4688:0610010F05Rik UTSW 11 23593449 missense probably benign
R5046:0610010F05Rik UTSW 11 23620354 missense probably benign 0.23
R5156:0610010F05Rik UTSW 11 23593424 critical splice donor site probably null
R5249:0610010F05Rik UTSW 11 23575483 makesense probably null
R5615:0610010F05Rik UTSW 11 23606759 missense probably damaging 0.96
X0026:0610010F05Rik UTSW 11 23576767 missense probably benign 0.00
X0067:0610010F05Rik UTSW 11 23593420 splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CACAGCTCATTACCACCATATATTC -3'
(R):5'- ATACCTTCTACAGTCATTCAAAGTACA -3'

Sequencing Primer
(F):5'- GTAAGTGGTTTCCTGACATCCACATG -3'
(R):5'- CAAAACCCAGTTACTGGC -3'
Posted OnFeb 04, 2016