Incidental Mutation 'R0420:Fancd2'
ID36983
Institutional Source Beutler Lab
Gene Symbol Fancd2
Ensembl Gene ENSMUSG00000034023
Gene NameFanconi anemia, complementation group D2
Synonyms2410150O07Rik
MMRRC Submission 038622-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0420 (G1)
Quality Score170
Status Validated
Chromosome6
Chromosomal Location113531682-113597017 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113536979 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 108 (L108P)
Ref Sequence ENSEMBL: ENSMUSP00000144928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036340] [ENSMUST00000204827]
Predicted Effect probably damaging
Transcript: ENSMUST00000036340
AA Change: L108P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045667
Gene: ENSMUSG00000034023
AA Change: L108P

DomainStartEndE-ValueType
Pfam:FancD2 1 1415 N/A PFAM
low complexity region 1430 1450 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000101051
SMART Domains Protein: ENSMUSP00000098612
Gene: ENSMUSG00000034023

DomainStartEndE-ValueType
Pfam:FancD2 1 129 1.3e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143535
Predicted Effect probably damaging
Transcript: ENSMUST00000204827
AA Change: L108P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144928
Gene: ENSMUSG00000034023
AA Change: L108P

DomainStartEndE-ValueType
Pfam:FancD2 1 1402 N/A PFAM
low complexity region 1417 1437 N/A INTRINSIC
Meta Mutation Damage Score 0.0716 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.2%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group D2. This protein is monoubiquinated in response to DNA damage, resulting in its localization to nuclear foci with other proteins (BRCA1 AND BRCA2) involved in homology-directed DNA repair. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutant mice exhibit defects observed in human patients with Fanconi anemia (FA) meiotic defects and germ cell loss. In addition, mutant mice display perinatal lethality, susceptiblity ot epithelial cancer, and microphthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik A G 15: 98,571,094 S17G probably benign Het
Abcb4 T C 5: 8,941,050 V870A probably benign Het
Adam6b A T 12: 113,489,994 M144L probably benign Het
Adrb2 T A 18: 62,179,539 I72L possibly damaging Het
Ankrd53 A T 6: 83,763,692 H99L probably damaging Het
Ap4e1 C T 2: 127,049,360 T17M probably damaging Het
Arnt T A 3: 95,470,394 probably benign Het
Atp1a3 C T 7: 24,980,627 G884E probably benign Het
Atp6v1b1 T C 6: 83,752,844 probably benign Het
Atp8a2 G T 14: 59,773,744 T971K probably damaging Het
BC048562 A T 9: 108,445,966 T167S probably benign Het
Brd9 A G 13: 73,955,473 M491V probably benign Het
Btnl10 A T 11: 58,923,451 D319V probably damaging Het
Cadps T A 14: 12,491,800 R783S probably damaging Het
Ccdc149 A G 5: 52,400,239 probably benign Het
Ccm2l A T 2: 153,070,862 D107V probably null Het
Cep192 A G 18: 67,813,893 E213G possibly damaging Het
Cyp2c37 A C 19: 39,995,794 N242T probably benign Het
Dnah17 A G 11: 118,039,939 V3750A probably damaging Het
Ehbp1 T A 11: 22,151,836 I231L probably benign Het
Emilin3 A G 2: 160,910,879 probably benign Het
Eya4 T C 10: 23,155,963 N254S possibly damaging Het
Fam184b A G 5: 45,584,512 S126P probably damaging Het
Fgf12 A T 16: 28,162,529 M145K possibly damaging Het
Gabbr1 A G 17: 37,046,762 N23S possibly damaging Het
Ggt1 T A 10: 75,576,213 probably benign Het
Gm1966 T A 7: 106,603,883 L51F probably damaging Het
Gm6434 T A 7: 25,882,361 noncoding transcript Het
Gm6614 T G 6: 141,985,477 probably benign Het
Grik4 A T 9: 42,622,096 L376* probably null Het
Gzf1 A G 2: 148,683,833 T75A probably benign Het
Hcn1 T C 13: 117,975,375 I625T unknown Het
Hhat C T 1: 192,552,934 probably null Het
Ifit1bl1 T C 19: 34,594,514 E181G probably damaging Het
Kif21a T C 15: 90,968,054 probably benign Het
Lrrc45 A C 11: 120,715,219 S118R probably damaging Het
Mcm9 T C 10: 53,548,527 I656V probably benign Het
Ms4a5 A G 19: 11,283,654 L47S probably damaging Het
Mynn A T 3: 30,607,459 N230I probably benign Het
Nck2 T C 1: 43,554,118 S162P probably damaging Het
Nfat5 T C 8: 107,367,461 F259S probably damaging Het
Obox1 T G 7: 15,556,253 S174A possibly damaging Het
Ociad1 T A 5: 73,313,429 probably null Het
Pgbd1 A T 13: 21,423,166 V286E possibly damaging Het
Phlpp2 T C 8: 109,939,935 V1032A probably damaging Het
Ppm1e C T 11: 87,240,614 A318T probably damaging Het
Prex1 T A 2: 166,589,571 D757V probably benign Het
Ptpdc1 C A 13: 48,589,119 probably null Het
Rbbp5 T G 1: 132,493,844 I94R possibly damaging Het
Rnpc3 A G 3: 113,621,869 V173A probably benign Het
Sgsm1 A T 5: 113,263,759 N700K probably benign Het
Sox14 T A 9: 99,875,122 H188L probably damaging Het
Supt5 T A 7: 28,317,329 probably benign Het
Synpo A G 18: 60,602,418 S819P probably damaging Het
Tenm2 A G 11: 36,207,124 probably benign Het
Tenm4 T C 7: 96,873,766 V1468A possibly damaging Het
Tiam2 A G 17: 3,502,918 N83S probably benign Het
Tle6 T C 10: 81,595,311 probably benign Het
Tm2d2 T G 8: 25,018,114 N91K probably damaging Het
Tmem132d T G 5: 127,864,646 Q463H probably benign Het
Tmf1 A G 6: 97,176,141 S324P probably damaging Het
Tnc T C 4: 64,000,159 T1172A probably benign Het
Usp17lb A T 7: 104,840,539 C393S probably benign Het
Usp42 G A 5: 143,714,861 L1136F probably damaging Het
Vmn2r92 T G 17: 18,168,921 M499R probably benign Het
Vps54 T A 11: 21,311,071 probably benign Het
Wdr6 C T 9: 108,573,101 R1076H probably benign Het
Wdr72 T A 9: 74,210,757 M917K possibly damaging Het
Wee2 T C 6: 40,456,995 V281A probably benign Het
Zc3h6 A G 2: 129,014,827 D609G probably benign Het
Zfp345 G A 2: 150,473,243 H125Y possibly damaging Het
Zhx2 A G 15: 57,821,840 K202E probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Fancd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Fancd2 APN 6 113564396 critical splice donor site probably null
IGL00475:Fancd2 APN 6 113568610 missense probably benign 0.01
IGL01319:Fancd2 APN 6 113584899 missense probably damaging 0.98
IGL01339:Fancd2 APN 6 113553752 missense probably benign 0.00
IGL01373:Fancd2 APN 6 113553752 missense probably benign 0.00
IGL01393:Fancd2 APN 6 113577360 splice site probably benign
IGL01630:Fancd2 APN 6 113563124 missense probably damaging 1.00
IGL01769:Fancd2 APN 6 113545111 missense possibly damaging 0.90
IGL01882:Fancd2 APN 6 113546640 missense probably benign 0.05
IGL02029:Fancd2 APN 6 113570975 missense probably benign 0.44
IGL02224:Fancd2 APN 6 113568320 critical splice donor site probably null
IGL02271:Fancd2 APN 6 113535759 splice site probably benign
IGL02352:Fancd2 APN 6 113563112 missense probably damaging 1.00
IGL02359:Fancd2 APN 6 113563112 missense probably damaging 1.00
IGL02427:Fancd2 APN 6 113549352 unclassified probably null
IGL02512:Fancd2 APN 6 113570943 missense probably damaging 1.00
IGL02530:Fancd2 APN 6 113562461 missense probably damaging 1.00
IGL02801:Fancd2 APN 6 113593317 missense probably benign 0.00
IGL03090:Fancd2 APN 6 113537597 splice site probably null
IGL03247:Fancd2 APN 6 113568208 missense probably benign 0.03
R0278:Fancd2 UTSW 6 113548448 critical splice donor site probably null
R0401:Fancd2 UTSW 6 113548343 missense possibly damaging 0.46
R0496:Fancd2 UTSW 6 113555130 splice site probably benign
R0762:Fancd2 UTSW 6 113574658 missense probably benign 0.20
R0827:Fancd2 UTSW 6 113586249 critical splice donor site probably null
R1225:Fancd2 UTSW 6 113535861 missense probably damaging 0.99
R1576:Fancd2 UTSW 6 113578405 missense probably damaging 0.98
R2010:Fancd2 UTSW 6 113593291 missense probably damaging 0.96
R2079:Fancd2 UTSW 6 113555187 missense probably damaging 1.00
R2118:Fancd2 UTSW 6 113560074 splice site probably benign
R2141:Fancd2 UTSW 6 113549321 missense probably benign 0.00
R2168:Fancd2 UTSW 6 113591159 missense possibly damaging 0.92
R2180:Fancd2 UTSW 6 113574637 missense probably benign 0.33
R3016:Fancd2 UTSW 6 113536726 missense probably benign 0.00
R3153:Fancd2 UTSW 6 113593269 missense possibly damaging 0.55
R3154:Fancd2 UTSW 6 113593269 missense possibly damaging 0.55
R3783:Fancd2 UTSW 6 113565204 missense probably damaging 1.00
R3786:Fancd2 UTSW 6 113565204 missense probably damaging 1.00
R3787:Fancd2 UTSW 6 113565204 missense probably damaging 1.00
R4379:Fancd2 UTSW 6 113561716 missense probably benign 0.00
R4388:Fancd2 UTSW 6 113556368 missense probably damaging 0.99
R4544:Fancd2 UTSW 6 113572642 critical splice acceptor site probably null
R4598:Fancd2 UTSW 6 113585477 missense probably benign 0.06
R4832:Fancd2 UTSW 6 113553722 missense probably benign 0.16
R4841:Fancd2 UTSW 6 113562430 missense probably damaging 1.00
R4922:Fancd2 UTSW 6 113585473 missense probably benign 0.03
R5375:Fancd2 UTSW 6 113568712 missense possibly damaging 0.93
R5579:Fancd2 UTSW 6 113560051 critical splice acceptor site probably null
R5782:Fancd2 UTSW 6 113548872 missense probably benign 0.00
R5871:Fancd2 UTSW 6 113556282 missense probably benign 0.30
R5901:Fancd2 UTSW 6 113549365 missense probably damaging 1.00
R5909:Fancd2 UTSW 6 113561711 missense probably benign
R6026:Fancd2 UTSW 6 113551770 missense possibly damaging 0.46
R6166:Fancd2 UTSW 6 113555251 missense possibly damaging 0.67
R6393:Fancd2 UTSW 6 113578413 missense probably benign 0.01
R6666:Fancd2 UTSW 6 113585509 missense probably damaging 0.96
R6669:Fancd2 UTSW 6 113593327 missense probably benign 0.00
R6676:Fancd2 UTSW 6 113537665 nonsense probably null
R6762:Fancd2 UTSW 6 113586016 intron probably null
R6911:Fancd2 UTSW 6 113548385 missense probably damaging 0.98
R6992:Fancd2 UTSW 6 113571018 critical splice donor site probably null
R7091:Fancd2 UTSW 6 113545101 missense probably damaging 1.00
R7252:Fancd2 UTSW 6 113556285 missense probably damaging 0.98
R7343:Fancd2 UTSW 6 113536939 missense probably benign 0.01
R7344:Fancd2 UTSW 6 113568709 missense probably benign 0.09
R7354:Fancd2 UTSW 6 113595946 missense unknown
Z1088:Fancd2 UTSW 6 113581422 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGAAGTGCATCGCCTGAGGACTG -3'
(R):5'- TGTGCCCATGCTGGAAAACAGAG -3'

Sequencing Primer
(F):5'- ACTGAGTCCCTGGCAACAG -3'
(R):5'- gaggaggaaaaagcaagcag -3'
Posted On2013-05-09