Incidental Mutation 'R4817:Csf3r'
ID369893
Institutional Source Beutler Lab
Gene Symbol Csf3r
Ensembl Gene ENSMUSG00000028859
Gene Namecolony stimulating factor 3 receptor (granulocyte)
SynonymsG-CSFR, Cd114, Csfgr
MMRRC Submission 042435-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.317) question?
Stock #R4817 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location126024550-126044440 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 126037656 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 477 (Y477*)
Ref Sequence ENSEMBL: ENSMUSP00000101768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030673] [ENSMUST00000106162]
Predicted Effect probably null
Transcript: ENSMUST00000030673
AA Change: Y477*
SMART Domains Protein: ENSMUSP00000030673
Gene: ENSMUSG00000028859
AA Change: Y477*

DomainStartEndE-ValueType
Pfam:Lep_receptor_Ig 24 111 2.3e-30 PFAM
FN3 124 213 5.38e1 SMART
SCOP:d1cd9b2 226 332 3e-15 SMART
Blast:FN3 334 420 3e-30 BLAST
FN3 432 518 2.41e0 SMART
FN3 530 612 1.92e-3 SMART
transmembrane domain 627 649 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106162
AA Change: Y477*
SMART Domains Protein: ENSMUSP00000101768
Gene: ENSMUSG00000028859
AA Change: Y477*

DomainStartEndE-ValueType
Pfam:Lep_receptor_Ig 22 112 6.8e-30 PFAM
FN3 124 213 5.38e1 SMART
SCOP:d1cd9b2 226 332 3e-15 SMART
Blast:FN3 334 420 3e-30 BLAST
FN3 432 518 2.41e0 SMART
FN3 530 612 1.92e-3 SMART
transmembrane domain 627 649 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140426
Meta Mutation Damage Score 0.6092 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (108/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the receptor for colony stimulating factor 3, a cytokine that controls the production, differentiation, and function of granulocytes. The encoded protein, which is a member of the family of cytokine receptors, may also function in some cell surface adhesion or recognition processes. Alternatively spliced transcript variants have been described. Mutations in this gene are a cause of Kostmann syndrome, also known as severe congenital neutropenia. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced numbers of peripheral neutrophils, with fewer hematopoietic progenitors in bone marrow and impaired expansion and terminal differentiation of progenitors into granulocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp2 T A 2: 91,203,618 D44E probably damaging Het
Acp5 T C 9: 22,127,083 I307M probably benign Het
Ahsa1 A G 12: 87,273,166 D245G possibly damaging Het
Ankrd40 A G 11: 94,339,633 K316E probably benign Het
Apol9b G A 15: 77,735,888 E295K possibly damaging Het
Aqp4 C A 18: 15,399,758 G93C probably damaging Het
Arhgap21 A G 2: 20,850,156 V1465A probably benign Het
Arhgap5 C T 12: 52,519,209 P988S possibly damaging Het
Asxl3 A C 18: 22,525,454 K2174Q probably damaging Het
Brf1 A T 12: 112,972,301 I250N probably damaging Het
Calm1 A G 12: 100,203,573 probably null Het
Ccdc33 C T 9: 58,067,535 V352M probably damaging Het
Ccdc88a G T 11: 29,460,907 K464N probably benign Het
Cdadc1 AGACGGA AGA 14: 59,568,991 probably null Het
Cdc25b T A 2: 131,193,303 I327N probably damaging Het
Cenpf G A 1: 189,682,369 H184Y possibly damaging Het
Col6a5 G A 9: 105,934,298 T674I unknown Het
Creg2 A T 1: 39,623,190 M258K probably damaging Het
Cyp3a44 T A 5: 145,803,755 Y25F possibly damaging Het
Degs2 T A 12: 108,689,066 R283* probably null Het
Dido1 T C 2: 180,661,416 N1565S probably benign Het
Dnah6 A T 6: 73,022,424 M4008K probably benign Het
Dnmbp C A 19: 43,849,972 G1138V probably benign Het
Drosha A C 15: 12,914,047 H1136P probably damaging Het
Duox2 T G 2: 122,296,515 N173T probably damaging Het
Dync1li1 T G 9: 114,705,094 I87M probably benign Het
E2f8 A C 7: 48,867,746 S770A probably benign Het
Efemp1 A G 11: 28,926,241 T469A probably damaging Het
Eif3f A T 7: 108,937,775 T136S probably damaging Het
Enpp5 T C 17: 44,080,980 *46R probably null Het
Epb41l4b A G 4: 57,103,428 V136A probably damaging Het
Fam186a A C 15: 99,933,538 probably benign Het
Flt4 A G 11: 49,625,415 Y115C probably damaging Het
Gal T A 19: 3,411,126 probably null Het
Galnt3 C T 2: 66,093,539 V462I possibly damaging Het
Gas2l1 A G 11: 5,061,429 S467P possibly damaging Het
Gbx1 A G 5: 24,526,206 L204P probably damaging Het
Gle1 T A 2: 29,936,211 S101T probably benign Het
Gltpd2 A C 11: 70,519,477 Q87P probably damaging Het
Gm12789 T A 4: 101,988,882 D113E probably damaging Het
Gm1966 T A 7: 106,601,230 noncoding transcript Het
Grin3b G A 10: 79,976,898 G936R probably benign Het
Gtf3c2 C T 5: 31,174,090 probably null Het
Klhl28 T C 12: 64,957,269 T157A probably benign Het
Kmt2a A G 9: 44,821,466 probably benign Het
Lamp1 A G 8: 13,172,541 T242A probably benign Het
Lhfpl5 T G 17: 28,576,326 I109S possibly damaging Het
Lhfpl5 T A 17: 28,582,988 *220R probably null Het
Map4k2 C T 19: 6,344,429 T313I probably damaging Het
Matn2 A G 15: 34,423,799 D601G probably damaging Het
Mcur1 C T 13: 43,551,671 V170M possibly damaging Het
Mettl7a3 A T 15: 100,335,333 D135V probably damaging Het
Mphosph10 T C 7: 64,392,221 probably benign Het
Nat8l G A 5: 34,001,043 A266T probably benign Het
Nckap5 G T 1: 126,027,215 D469E possibly damaging Het
Nckap5l G T 15: 99,423,186 P1238T probably damaging Het
Ngf A G 3: 102,509,840 probably benign Het
Ntng1 T A 3: 109,934,868 L196F probably damaging Het
Odf3l2 G A 10: 79,640,017 P238S probably damaging Het
Olfr1396 A T 11: 49,113,621 V35D probably damaging Het
Olfr450 A G 6: 42,817,962 I164V possibly damaging Het
Pclo A T 5: 14,675,031 Y1301F unknown Het
Pclo A G 5: 14,713,125 T3871A unknown Het
Peli3 T C 19: 4,932,566 E357G probably damaging Het
Pkd1 T A 17: 24,565,374 probably null Het
Pla2g2c T G 4: 138,734,334 F38C probably damaging Het
Plekha2 T A 8: 25,059,944 T126S possibly damaging Het
Polr3f T A 2: 144,534,081 *142K probably null Het
Ppcs C T 4: 119,419,146 V81M probably benign Het
Prl7a1 A G 13: 27,635,764 I169T probably damaging Het
Rbm19 C A 5: 120,133,734 probably benign Het
Rdh7 T A 10: 127,885,762 Y215F probably benign Het
Rragd T G 4: 32,995,072 S62R probably benign Het
Rtel1 T C 2: 181,355,935 S1114P possibly damaging Het
Serpinb5 G T 1: 106,872,339 L86F probably damaging Het
Setbp1 A G 18: 78,858,800 S551P probably damaging Het
Setd6 T C 8: 95,717,055 probably benign Het
Slmap A C 14: 26,462,352 M292R probably damaging Het
Srrm4 T C 5: 116,477,134 D97G unknown Het
Stk-ps2 G A 1: 46,028,965 noncoding transcript Het
Syce1 A T 7: 140,778,423 M204K probably benign Het
Syk A G 13: 52,611,206 K123R probably benign Het
Tbc1d14 A T 5: 36,571,831 S64T probably damaging Het
Traf3ip3 T C 1: 193,184,829 K295E probably damaging Het
Trp53bp2 T C 1: 182,441,805 probably null Het
Tsc2 T A 17: 24,596,742 probably null Het
Tspyl4 T A 10: 34,297,738 C75* probably null Het
Uqcc2 T C 17: 27,125,159 I52V probably benign Het
Vcp T A 4: 42,983,486 T525S probably damaging Het
Vmn2r18 A T 5: 151,585,432 probably null Het
Vmp1 A G 11: 86,602,053 V310A probably benign Het
Vps13d T A 4: 145,069,165 R3671S probably damaging Het
Wdr3 T C 3: 100,146,545 T544A possibly damaging Het
Zc3h14 C G 12: 98,752,848 D157E probably damaging Het
Zfp541 T A 7: 16,090,382 F1010I probably damaging Het
Zfp64 T C 2: 168,926,112 T527A probably benign Het
Zyx G T 6: 42,356,487 R449M probably damaging Het
Other mutations in Csf3r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02059:Csf3r APN 4 126032127 nonsense probably null
IGL02224:Csf3r APN 4 126043539 missense probably benign 0.36
IGL02558:Csf3r APN 4 126038135 splice site probably benign
R0026:Csf3r UTSW 4 126031884 missense probably benign 0.33
R0033:Csf3r UTSW 4 126031884 missense probably benign 0.33
R0033:Csf3r UTSW 4 126031884 missense probably benign 0.33
R0121:Csf3r UTSW 4 126029849 missense probably benign 0.01
R0413:Csf3r UTSW 4 126039667 splice site probably benign
R0456:Csf3r UTSW 4 126035861 missense probably damaging 0.98
R0479:Csf3r UTSW 4 126043823 missense probably damaging 0.98
R1052:Csf3r UTSW 4 126042988 splice site probably null
R1466:Csf3r UTSW 4 126031932 splice site probably benign
R1512:Csf3r UTSW 4 126029984 missense possibly damaging 0.75
R1902:Csf3r UTSW 4 126042918 missense probably damaging 1.00
R1905:Csf3r UTSW 4 126042745 missense probably benign 0.12
R2520:Csf3r UTSW 4 126035352 missense probably benign 0.06
R3424:Csf3r UTSW 4 126043756 missense probably damaging 1.00
R3705:Csf3r UTSW 4 126032285 missense possibly damaging 0.76
R3907:Csf3r UTSW 4 126034447 missense probably benign 0.00
R4514:Csf3r UTSW 4 126039860 missense possibly damaging 0.61
R5111:Csf3r UTSW 4 126030068 splice site probably null
R5120:Csf3r UTSW 4 126035827 missense probably benign 0.00
R5308:Csf3r UTSW 4 126035344 missense probably benign 0.00
R5912:Csf3r UTSW 4 126029960 missense probably damaging 1.00
R6018:Csf3r UTSW 4 126043621 missense probably benign 0.01
R6024:Csf3r UTSW 4 126037517 splice site probably null
R7144:Csf3r UTSW 4 126043722 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCTCCCTGGTATGACTGTTG -3'
(R):5'- CCCCAGGTAAGGTTTCAGAAAAG -3'

Sequencing Primer
(F):5'- GGTATTGACATACCCTGGATCACAG -3'
(R):5'- CAGGTAAGGTTTCAGAAAAGGCTGG -3'
Posted On2016-02-04