Incidental Mutation 'R4817:Dync1li1'
ID369920
Institutional Source Beutler Lab
Gene Symbol Dync1li1
Ensembl Gene ENSMUSG00000032435
Gene Namedynein cytoplasmic 1 light intermediate chain 1
SynonymsDnclic1, 1110053F02Rik, LIC-1
MMRRC Submission 042435-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.624) question?
Stock #R4817 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location114688790-114724302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 114705094 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 87 (I87M)
Ref Sequence ENSEMBL: ENSMUSP00000035366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047404]
Predicted Effect probably benign
Transcript: ENSMUST00000047404
AA Change: I87M

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000035366
Gene: ENSMUSG00000032435
AA Change: I87M

DomainStartEndE-ValueType
Pfam:DLIC 43 519 2.7e-258 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215345
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (108/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to light intermediate subunit family, whose members are components of the multiprotein cytoplasmic dynein complex, which is involved in intracellular trafficking and chromosome segregation during mitosis. The protein plays a role in moving the spindle assembly checkpoint (SAC) from kinetochores to spindle poles. The protein may also mediate binding to other cargo molecules to facilitate intracellular vesicle trafficking. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit increased anxiety-related response, increased dendrite length, increased neuron migration, and decreased lysosome trafficking. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp2 T A 2: 91,203,618 D44E probably damaging Het
Acp5 T C 9: 22,127,083 I307M probably benign Het
Ahsa1 A G 12: 87,273,166 D245G possibly damaging Het
Ankrd40 A G 11: 94,339,633 K316E probably benign Het
Apol9b G A 15: 77,735,888 E295K possibly damaging Het
Aqp4 C A 18: 15,399,758 G93C probably damaging Het
Arhgap21 A G 2: 20,850,156 V1465A probably benign Het
Arhgap5 C T 12: 52,519,209 P988S possibly damaging Het
Asxl3 A C 18: 22,525,454 K2174Q probably damaging Het
Brf1 A T 12: 112,972,301 I250N probably damaging Het
Calm1 A G 12: 100,203,573 probably null Het
Ccdc33 C T 9: 58,067,535 V352M probably damaging Het
Ccdc88a G T 11: 29,460,907 K464N probably benign Het
Cdadc1 AGACGGA AGA 14: 59,568,991 probably null Het
Cdc25b T A 2: 131,193,303 I327N probably damaging Het
Cenpf G A 1: 189,682,369 H184Y possibly damaging Het
Col6a5 G A 9: 105,934,298 T674I unknown Het
Creg2 A T 1: 39,623,190 M258K probably damaging Het
Csf3r T A 4: 126,037,656 Y477* probably null Het
Cyp3a44 T A 5: 145,803,755 Y25F possibly damaging Het
Degs2 T A 12: 108,689,066 R283* probably null Het
Dido1 T C 2: 180,661,416 N1565S probably benign Het
Dnah6 A T 6: 73,022,424 M4008K probably benign Het
Dnmbp C A 19: 43,849,972 G1138V probably benign Het
Drosha A C 15: 12,914,047 H1136P probably damaging Het
Duox2 T G 2: 122,296,515 N173T probably damaging Het
E2f8 A C 7: 48,867,746 S770A probably benign Het
Efemp1 A G 11: 28,926,241 T469A probably damaging Het
Eif3f A T 7: 108,937,775 T136S probably damaging Het
Enpp5 T C 17: 44,080,980 *46R probably null Het
Epb41l4b A G 4: 57,103,428 V136A probably damaging Het
Fam186a A C 15: 99,933,538 probably benign Het
Flt4 A G 11: 49,625,415 Y115C probably damaging Het
Gal T A 19: 3,411,126 probably null Het
Galnt3 C T 2: 66,093,539 V462I possibly damaging Het
Gas2l1 A G 11: 5,061,429 S467P possibly damaging Het
Gbx1 A G 5: 24,526,206 L204P probably damaging Het
Gle1 T A 2: 29,936,211 S101T probably benign Het
Gltpd2 A C 11: 70,519,477 Q87P probably damaging Het
Gm12789 T A 4: 101,988,882 D113E probably damaging Het
Gm1966 T A 7: 106,601,230 noncoding transcript Het
Grin3b G A 10: 79,976,898 G936R probably benign Het
Gtf3c2 C T 5: 31,174,090 probably null Het
Klhl28 T C 12: 64,957,269 T157A probably benign Het
Kmt2a A G 9: 44,821,466 probably benign Het
Lamp1 A G 8: 13,172,541 T242A probably benign Het
Lhfpl5 T G 17: 28,576,326 I109S possibly damaging Het
Lhfpl5 T A 17: 28,582,988 *220R probably null Het
Map4k2 C T 19: 6,344,429 T313I probably damaging Het
Matn2 A G 15: 34,423,799 D601G probably damaging Het
Mcur1 C T 13: 43,551,671 V170M possibly damaging Het
Mettl7a3 A T 15: 100,335,333 D135V probably damaging Het
Mphosph10 T C 7: 64,392,221 probably benign Het
Nat8l G A 5: 34,001,043 A266T probably benign Het
Nckap5 G T 1: 126,027,215 D469E possibly damaging Het
Nckap5l G T 15: 99,423,186 P1238T probably damaging Het
Ngf A G 3: 102,509,840 probably benign Het
Ntng1 T A 3: 109,934,868 L196F probably damaging Het
Odf3l2 G A 10: 79,640,017 P238S probably damaging Het
Olfr1396 A T 11: 49,113,621 V35D probably damaging Het
Olfr450 A G 6: 42,817,962 I164V possibly damaging Het
Pclo A T 5: 14,675,031 Y1301F unknown Het
Pclo A G 5: 14,713,125 T3871A unknown Het
Peli3 T C 19: 4,932,566 E357G probably damaging Het
Pkd1 T A 17: 24,565,374 probably null Het
Pla2g2c T G 4: 138,734,334 F38C probably damaging Het
Plekha2 T A 8: 25,059,944 T126S possibly damaging Het
Polr3f T A 2: 144,534,081 *142K probably null Het
Ppcs C T 4: 119,419,146 V81M probably benign Het
Prl7a1 A G 13: 27,635,764 I169T probably damaging Het
Rbm19 C A 5: 120,133,734 probably benign Het
Rdh7 T A 10: 127,885,762 Y215F probably benign Het
Rragd T G 4: 32,995,072 S62R probably benign Het
Rtel1 T C 2: 181,355,935 S1114P possibly damaging Het
Serpinb5 G T 1: 106,872,339 L86F probably damaging Het
Setbp1 A G 18: 78,858,800 S551P probably damaging Het
Setd6 T C 8: 95,717,055 probably benign Het
Slmap A C 14: 26,462,352 M292R probably damaging Het
Srrm4 T C 5: 116,477,134 D97G unknown Het
Stk-ps2 G A 1: 46,028,965 noncoding transcript Het
Syce1 A T 7: 140,778,423 M204K probably benign Het
Syk A G 13: 52,611,206 K123R probably benign Het
Tbc1d14 A T 5: 36,571,831 S64T probably damaging Het
Traf3ip3 T C 1: 193,184,829 K295E probably damaging Het
Trp53bp2 T C 1: 182,441,805 probably null Het
Tsc2 T A 17: 24,596,742 probably null Het
Tspyl4 T A 10: 34,297,738 C75* probably null Het
Uqcc2 T C 17: 27,125,159 I52V probably benign Het
Vcp T A 4: 42,983,486 T525S probably damaging Het
Vmn2r18 A T 5: 151,585,432 probably null Het
Vmp1 A G 11: 86,602,053 V310A probably benign Het
Vps13d T A 4: 145,069,165 R3671S probably damaging Het
Wdr3 T C 3: 100,146,545 T544A possibly damaging Het
Zc3h14 C G 12: 98,752,848 D157E probably damaging Het
Zfp541 T A 7: 16,090,382 F1010I probably damaging Het
Zfp64 T C 2: 168,926,112 T527A probably benign Het
Zyx G T 6: 42,356,487 R449M probably damaging Het
Other mutations in Dync1li1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Dync1li1 APN 9 114720597 missense possibly damaging 0.89
R1510:Dync1li1 UTSW 9 114689210 missense possibly damaging 0.59
R1824:Dync1li1 UTSW 9 114709184 missense probably benign 0.01
R1955:Dync1li1 UTSW 9 114721746 missense probably damaging 0.99
R2000:Dync1li1 UTSW 9 114713563 missense probably benign 0.05
R2520:Dync1li1 UTSW 9 114689006 missense probably null 0.17
R2912:Dync1li1 UTSW 9 114715675 missense probably benign 0.31
R4418:Dync1li1 UTSW 9 114706170 missense probably damaging 1.00
R4422:Dync1li1 UTSW 9 114709309 missense probably damaging 1.00
R4646:Dync1li1 UTSW 9 114709169 missense probably damaging 0.96
R4693:Dync1li1 UTSW 9 114706098 missense probably damaging 0.99
R5027:Dync1li1 UTSW 9 114713544 missense probably damaging 1.00
R5274:Dync1li1 UTSW 9 114715205 missense possibly damaging 0.84
R5363:Dync1li1 UTSW 9 114715229 missense probably damaging 0.99
R5902:Dync1li1 UTSW 9 114717861 critical splice acceptor site probably null
R6359:Dync1li1 UTSW 9 114713570 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TTTAGCCAGGTAGCAGCAGTAC -3'
(R):5'- TAGAACTCCTGCTGAGCAATG -3'

Sequencing Primer
(F):5'- TGGAGTCTGTGTCCCCCAG -3'
(R):5'- TCCTGCTGAGCAATGACAAACTAG -3'
Posted On2016-02-04