Incidental Mutation 'R4818:Pax3'
ID369966
Institutional Source Beutler Lab
Gene Symbol Pax3
Ensembl Gene ENSMUSG00000004872
Gene Namepaired box 3
SynonymsPax-3
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.761) question?
Stock #R4818 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location78101267-78197134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78132232 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 263 (V263A)
Ref Sequence ENSEMBL: ENSMUSP00000004994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004994] [ENSMUST00000087086]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004994
AA Change: V263A

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000004994
Gene: ENSMUSG00000004872
AA Change: V263A

DomainStartEndE-ValueType
PAX 34 159 1.99e-91 SMART
low complexity region 164 185 N/A INTRINSIC
HOX 219 281 6.6e-27 SMART
Pfam:Pax7 347 391 5.9e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000087086
AA Change: V263A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084320
Gene: ENSMUSG00000004872
AA Change: V263A

DomainStartEndE-ValueType
PAX 34 159 1.99e-91 SMART
low complexity region 164 185 N/A INTRINSIC
HOX 219 281 6.6e-27 SMART
Pfam:Pax7 346 391 5.3e-27 PFAM
Meta Mutation Damage Score 0.69 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the paired box (PAX) family of transcription factors. Members of the PAX family typically contain a paired box domain and a paired-type homeodomain. These genes play critical roles during fetal development. Mutations in paired box gene 3 are associated with Waardenburg syndrome, craniofacial-deafness-hand syndrome, and alveolar rhabdomyosarcoma. The translocation t(2;13)(q35;q14), which represents a fusion between PAX3 and the forkhead gene, is a frequent finding in alveolar rhabdomyosarcoma. Alternative splicing results in transcripts encoding isoforms with different C-termini. [provided by RefSeq, Jul 2008]
PHENOTYPE: Effects on homozygotes for mutations in this gene vary in severity and include embryonic to perinatal death, malformations of neural tube, spinal ganglia, heart, vertebral column, hindbrain and limb musculature. Heterozygotes have white belly spots and variable spotting on the back and extremeties. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,741,466 E562G probably benign Het
5730522E02Rik A G 11: 25,770,472 probably null Het
A930033H14Rik A T 10: 69,212,360 F93Y probably benign Het
Abca17 C T 17: 24,317,161 E511K probably damaging Het
Abca9 C T 11: 110,155,154 probably null Het
Abhd5 T A 9: 122,363,800 probably null Het
Adra2b G A 2: 127,364,092 W176* probably null Het
Aldh1l1 T C 6: 90,596,915 Y799H probably benign Het
Arfgef1 A G 1: 10,216,547 V46A probably benign Het
Arhgap40 A G 2: 158,539,719 E377G probably damaging Het
Arhgef5 G A 6: 43,273,550 V412I probably benign Het
Arid3c T C 4: 41,730,072 E41G possibly damaging Het
Atp8b4 T A 2: 126,322,816 K1193N probably benign Het
C4a C T 17: 34,816,999 noncoding transcript Het
Chst2 C T 9: 95,405,364 D310N probably damaging Het
Crtc3 T C 7: 80,677,422 Q52R possibly damaging Het
Crybg1 T C 10: 43,998,587 I842V probably benign Het
Dennd4c T C 4: 86,825,274 S1167P probably benign Het
Edem3 T C 1: 151,792,385 V305A possibly damaging Het
Epha10 T A 4: 124,886,214 probably null Het
Epha6 C A 16: 59,654,063 R1117L probably damaging Het
Fdx1l T C 9: 21,067,864 I144V possibly damaging Het
Gm10762 C T 2: 128,967,186 W81* probably null Het
Gm14139 T A 2: 150,192,061 C132S probably damaging Het
Gm4737 G A 16: 46,154,192 T274I probably damaging Het
Hus1 A G 11: 8,996,808 probably benign Het
Igbp1b C T 6: 138,657,805 E214K probably benign Het
Inpp5f A G 7: 128,685,129 I577M probably damaging Het
Kansl2 G A 15: 98,526,661 T296I possibly damaging Het
Kcna6 A G 6: 126,738,424 F501L probably benign Het
Kirrel2 A T 7: 30,449,868 V579D probably benign Het
Larp1b T C 3: 40,970,570 Y208H probably damaging Het
Lipf A T 19: 33,965,688 D132V probably benign Het
Lsm12 T C 11: 102,167,163 K98E probably damaging Het
Mastl A G 2: 23,137,026 S275P probably benign Het
Mrpl44 A G 1: 79,780,977 I281V probably benign Het
Mtf1 T A 4: 124,804,712 M1K probably null Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myh2 G A 11: 67,176,255 G179R probably damaging Het
Nfasc T C 1: 132,603,830 T739A possibly damaging Het
Nfatc3 G A 8: 106,108,379 V778I probably benign Het
Notch4 A G 17: 34,578,716 probably benign Het
Npm2 T C 14: 70,652,402 N24S probably benign Het
Obox7 T A 7: 14,664,485 L108Q probably damaging Het
Olfr615 T A 7: 103,560,761 F95I probably benign Het
Pdlim1 C T 19: 40,223,136 V238I probably damaging Het
Pik3ip1 G A 11: 3,330,928 probably benign Het
Ptprq A G 10: 107,710,581 V284A possibly damaging Het
Rad9b G A 5: 122,339,776 T179I probably damaging Het
Rrnad1 C A 3: 87,924,998 R293L probably benign Het
Sirt4 G T 5: 115,479,726 D290E possibly damaging Het
Skint6 T A 4: 112,955,392 probably benign Het
Slc18a1 A C 8: 69,040,299 I466S probably damaging Het
Slc35e4 C T 11: 3,912,889 R100H probably benign Het
Sptbn5 T G 2: 120,067,968 K470Q probably benign Het
Tas1r1 C G 4: 152,032,674 V168L probably benign Het
Tmem233 T A 5: 116,083,163 Q8L possibly damaging Het
Ttc17 G T 2: 94,332,891 Q862K possibly damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp229 T C 17: 21,743,904 I68T probably benign Het
Zfp423 A G 8: 87,904,500 V30A probably benign Het
Other mutations in Pax3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01642:Pax3 APN 1 78196663 unclassified probably null
IGL02249:Pax3 APN 1 78195325 missense probably damaging 0.98
IGL02271:Pax3 APN 1 78195332 missense probably damaging 1.00
IGL02376:Pax3 APN 1 78132292 missense probably damaging 1.00
IGL02530:Pax3 APN 1 78121787 missense possibly damaging 0.87
IGL02950:Pax3 APN 1 78103360 missense probably benign 0.06
Nidoqueen UTSW 1 78132232 missense probably damaging 1.00
stemware UTSW 1 78132347 missense
Widget UTSW 1 78122590 critical splice donor site probably null
R0049:Pax3 UTSW 1 78103504 missense probably damaging 1.00
R0049:Pax3 UTSW 1 78103504 missense probably damaging 1.00
R0523:Pax3 UTSW 1 78195441 missense possibly damaging 0.83
R1575:Pax3 UTSW 1 78103484 missense probably benign 0.00
R1831:Pax3 UTSW 1 78132340 missense probably damaging 1.00
R1934:Pax3 UTSW 1 78103480 missense possibly damaging 0.90
R2420:Pax3 UTSW 1 78196864 unclassified probably null
R2473:Pax3 UTSW 1 78122590 critical splice donor site probably null
R4430:Pax3 UTSW 1 78195324 missense probably damaging 1.00
R4693:Pax3 UTSW 1 78196746 missense probably benign 0.00
R4860:Pax3 UTSW 1 78192456 missense possibly damaging 0.78
R4860:Pax3 UTSW 1 78192456 missense possibly damaging 0.78
R5302:Pax3 UTSW 1 78121612 missense possibly damaging 0.88
R5475:Pax3 UTSW 1 78103418 missense probably benign 0.06
R5855:Pax3 UTSW 1 78121651 missense probably damaging 0.99
R6102:Pax3 UTSW 1 78132347 missense probably damaging 1.00
R6190:Pax3 UTSW 1 78192549 missense possibly damaging 0.63
R6856:Pax3 UTSW 1 78132419 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAAGCACTGTTCACTGTTGC -3'
(R):5'- ACCTCAGTCAGATGAAGGCTC -3'

Sequencing Primer
(F):5'- AGCACTGTTCACTGTTGCTAATATGG -3'
(R):5'- CAGATGAAGGCTCCGATATTGACTC -3'
Posted OnFeb 04, 2016