Incidental Mutation 'R4818:Zfp423'
ID370001
Institutional Source Beutler Lab
Gene Symbol Zfp423
Ensembl Gene ENSMUSG00000045333
Gene Namezinc finger protein 423
SynonymsZfp104, ataxia1, Ebfaz, Roaz
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.857) question?
Stock #R4818 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location87661810-87959595 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87904500 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 30 (V30A)
Ref Sequence ENSEMBL: ENSMUSP00000105282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109655] [ENSMUST00000174764]
Predicted Effect probably benign
Transcript: ENSMUST00000109655
AA Change: V30A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000105282
Gene: ENSMUSG00000045333
AA Change: V30A

DomainStartEndE-ValueType
low complexity region 60 72 N/A INTRINSIC
ZnF_C2H2 75 96 5.07e0 SMART
low complexity region 128 144 N/A INTRINSIC
ZnF_C2H2 146 168 1.28e-3 SMART
ZnF_C2H2 174 196 1.64e-1 SMART
ZnF_C2H2 202 224 2.05e-2 SMART
ZnF_C2H2 230 252 3.21e-4 SMART
ZnF_C2H2 271 294 5.42e-2 SMART
ZnF_C2H2 303 326 1.76e-1 SMART
ZnF_C2H2 331 353 8.67e-1 SMART
low complexity region 371 385 N/A INTRINSIC
ZnF_C2H2 417 441 1.16e-1 SMART
ZnF_C2H2 449 472 3.52e-1 SMART
ZnF_C2H2 488 511 7.9e-4 SMART
low complexity region 513 524 N/A INTRINSIC
ZnF_C2H2 525 548 2.53e-2 SMART
ZnF_C2H2 571 596 3.99e0 SMART
low complexity region 612 623 N/A INTRINSIC
ZnF_C2H2 640 662 3.16e-3 SMART
ZnF_C2H2 670 692 5.81e-2 SMART
ZnF_C2H2 700 723 4.87e-4 SMART
ZnF_C2H2 728 751 7.26e-3 SMART
ZnF_C2H2 758 781 4.79e-3 SMART
ZnF_C2H2 789 811 1.36e-2 SMART
ZnF_C2H2 815 838 4.72e-2 SMART
ZnF_C2H2 894 917 4.12e0 SMART
ZnF_C2H2 938 960 5.59e-4 SMART
ZnF_C2H2 967 989 6.42e-4 SMART
ZnF_C2H2 996 1018 4.94e0 SMART
ZnF_C2H2 1028 1050 4.99e1 SMART
ZnF_C2H2 1128 1151 1.12e-3 SMART
ZnF_C2H2 1176 1198 1.45e-2 SMART
ZnF_C2H2 1206 1228 5.72e-1 SMART
ZnF_C2H2 1237 1260 1.18e-2 SMART
ZnF_C2H2 1267 1290 4.05e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173725
Predicted Effect probably benign
Transcript: ENSMUST00000174764
AA Change: V33A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000134575
Gene: ENSMUSG00000045333
AA Change: V33A

DomainStartEndE-ValueType
low complexity region 63 75 N/A INTRINSIC
ZnF_C2H2 78 99 5.07e0 SMART
low complexity region 131 147 N/A INTRINSIC
ZnF_C2H2 149 171 1.28e-3 SMART
ZnF_C2H2 177 199 1.64e-1 SMART
ZnF_C2H2 205 227 2.05e-2 SMART
Pfam:zf-C2H2_6 232 244 2.5e-1 PFAM
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear protein that belongs to the family of Kruppel-like C2H2 zinc finger proteins. It functions as a DNA-binding transcription factor by using distinct zinc fingers in different signaling pathways. Thus, it is thought that this gene may have multiple roles in signal transduction during development. Mutations in this gene are associated with nephronophthisis-14 and Joubert syndrome-19. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mutations in this gene lead to postnatal lethality, abnormal gait, ataxia, reduced body size, loss of the corpus callosum, reduction of the hippocampus, olfactory bulb defects, and variable malformation of the cerebellum, including vermis agenesis, due to reduced proliferation of neural precursors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,741,466 E562G probably benign Het
5730522E02Rik A G 11: 25,770,472 probably null Het
A930033H14Rik A T 10: 69,212,360 probably benign Het
Abca17 C T 17: 24,317,161 E511K probably damaging Het
Abca9 C T 11: 110,155,154 probably null Het
Abhd5 T A 9: 122,363,800 probably null Het
Adra2b G A 2: 127,364,092 W171* probably null Het
Aldh1l1 T C 6: 90,596,915 Y799H probably benign Het
Arfgef1 A G 1: 10,216,547 V46A probably benign Het
Arhgap40 A G 2: 158,539,719 E374G probably damaging Het
Arhgef5 G A 6: 43,273,550 V412I probably benign Het
Arid3c T C 4: 41,730,072 E41G possibly damaging Het
Atp8b4 T A 2: 126,322,816 K1193N probably benign Het
C4a C T 17: 34,816,999 noncoding transcript Het
Chst2 C T 9: 95,405,364 D310N probably damaging Het
Crtc3 T C 7: 80,677,422 Q52R possibly damaging Het
Crybg1 T C 10: 43,998,587 I842V probably benign Het
Dennd4c T C 4: 86,825,274 S1167P probably benign Het
Edem3 T C 1: 151,792,385 V305A possibly damaging Het
Epha10 T A 4: 124,886,214 probably null Het
Epha6 C A 16: 59,654,063 R1117L probably damaging Het
Fdx1l T C 9: 21,067,864 I144V possibly damaging Het
Gm10762 C T 2: 128,967,186 W81* probably null Het
Gm14139 T A 2: 150,192,061 C132S probably damaging Het
Gm4737 G A 16: 46,154,192 T274I probably damaging Het
Hus1 A G 11: 8,996,808 probably benign Het
Igbp1b C T 6: 138,657,805 E214K probably benign Het
Inpp5f A G 7: 128,685,129 I577M probably damaging Het
Kansl2 G A 15: 98,526,661 T296I possibly damaging Het
Kcna6 A G 6: 126,738,424 F501L probably benign Het
Kirrel2 A T 7: 30,449,868 V579D probably benign Het
Larp1b T C 3: 40,970,570 Y208H probably damaging Het
Lipf A T 19: 33,965,688 D132V probably benign Het
Lsm12 T C 11: 102,167,163 K40E probably damaging Het
Mastl A G 2: 23,137,026 S275P probably benign Het
Mrpl44 A G 1: 79,780,977 I281V probably benign Het
Mtf1 T A 4: 124,804,712 M1K probably null Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myh2 G A 11: 67,176,255 G179R probably damaging Het
Nfasc T C 1: 132,603,830 T739A possibly damaging Het
Nfatc3 G A 8: 106,108,379 V778I probably benign Het
Notch4 A G 17: 34,578,716 probably benign Het
Npm2 T C 14: 70,652,402 N24S probably benign Het
Obox7 T A 7: 14,664,485 L108Q probably damaging Het
Olfr615 T A 7: 103,560,761 F95I probably benign Het
Pax3 A G 1: 78,132,232 V263A probably damaging Het
Pdlim1 C T 19: 40,223,136 V238I probably damaging Het
Pik3ip1 G A 11: 3,330,928 probably benign Het
Ptprq A G 10: 107,710,581 V284A possibly damaging Het
Rad9b G A 5: 122,339,776 T179I probably damaging Het
Rrnad1 C A 3: 87,924,998 R293L probably benign Het
Sirt4 G T 5: 115,479,726 D290E possibly damaging Het
Skint6 T A 4: 112,955,392 probably benign Het
Slc18a1 A C 8: 69,040,299 I466S probably damaging Het
Slc35e4 C T 11: 3,912,889 R100H probably benign Het
Sptbn5 T G 2: 120,067,968 K470Q probably benign Het
Tas1r1 C G 4: 152,032,674 V168L probably benign Het
Tmem233 T A 5: 116,083,163 Q8L possibly damaging Het
Ttc17 G T 2: 94,332,891 Q862K possibly damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp229 T C 17: 21,743,904 I68T probably benign Het
Other mutations in Zfp423
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Zfp423 APN 8 87781611 unclassified probably null
IGL01359:Zfp423 APN 8 87780662 missense probably damaging 1.00
IGL01780:Zfp423 APN 8 87781508 missense probably damaging 1.00
IGL02250:Zfp423 APN 8 87783255 missense probably damaging 1.00
IGL02301:Zfp423 APN 8 87781574 missense probably damaging 1.00
IGL02320:Zfp423 APN 8 87781602 missense probably damaging 1.00
IGL02804:Zfp423 APN 8 87782657 missense probably benign 0.02
IGL03090:Zfp423 APN 8 87781443 missense probably damaging 1.00
IGL03198:Zfp423 APN 8 87781676 missense possibly damaging 0.73
IGL03383:Zfp423 APN 8 87859452 nonsense probably null
swell UTSW 8 87686559 splice site probably null
R0110:Zfp423 UTSW 8 87782259 missense possibly damaging 0.60
R0142:Zfp423 UTSW 8 87780340 nonsense probably null
R0256:Zfp423 UTSW 8 87773634 nonsense probably null
R0538:Zfp423 UTSW 8 87782085 missense probably damaging 0.99
R0542:Zfp423 UTSW 8 87780609 missense probably damaging 1.00
R0614:Zfp423 UTSW 8 87782114 missense probably damaging 1.00
R1179:Zfp423 UTSW 8 87688072 missense probably damaging 0.97
R1417:Zfp423 UTSW 8 87773656 splice site probably null
R1429:Zfp423 UTSW 8 87686442 missense probably damaging 0.99
R1570:Zfp423 UTSW 8 87782558 missense probably benign 0.37
R2013:Zfp423 UTSW 8 87782397 missense probably benign 0.43
R2043:Zfp423 UTSW 8 87782618 missense probably damaging 1.00
R2064:Zfp423 UTSW 8 87781358 missense probably benign 0.04
R2108:Zfp423 UTSW 8 87781178 missense possibly damaging 0.73
R2358:Zfp423 UTSW 8 87780551 missense possibly damaging 0.56
R3177:Zfp423 UTSW 8 87782331 missense probably damaging 1.00
R3277:Zfp423 UTSW 8 87782331 missense probably damaging 1.00
R3738:Zfp423 UTSW 8 87781344 missense probably damaging 1.00
R3739:Zfp423 UTSW 8 87781344 missense probably damaging 1.00
R3773:Zfp423 UTSW 8 87780512 missense probably benign 0.03
R4034:Zfp423 UTSW 8 87781344 missense probably damaging 1.00
R4425:Zfp423 UTSW 8 87782973 missense probably damaging 1.00
R4611:Zfp423 UTSW 8 87688081 missense possibly damaging 0.90
R4700:Zfp423 UTSW 8 87781710 unclassified probably null
R4753:Zfp423 UTSW 8 87781446 missense probably benign 0.00
R5026:Zfp423 UTSW 8 87780674 missense probably damaging 1.00
R5190:Zfp423 UTSW 8 87782463 missense probably damaging 1.00
R5243:Zfp423 UTSW 8 87773647 missense probably benign 0.03
R5284:Zfp423 UTSW 8 87781677 missense possibly damaging 0.73
R5586:Zfp423 UTSW 8 87859340 missense possibly damaging 0.93
R5601:Zfp423 UTSW 8 87782009 missense probably damaging 1.00
R5671:Zfp423 UTSW 8 87782327 missense probably damaging 0.99
R5717:Zfp423 UTSW 8 87686559 splice site probably null
R5801:Zfp423 UTSW 8 87859362 missense probably damaging 0.99
R5917:Zfp423 UTSW 8 87782232 nonsense probably null
R5985:Zfp423 UTSW 8 87782146 missense possibly damaging 0.83
R6111:Zfp423 UTSW 8 87782687 missense probably damaging 0.99
R6306:Zfp423 UTSW 8 87782034 missense possibly damaging 0.64
R6770:Zfp423 UTSW 8 87781817 missense probably damaging 0.99
R6970:Zfp423 UTSW 8 87803779 missense probably benign 0.00
R7029:Zfp423 UTSW 8 87688066 missense probably damaging 0.99
R7060:Zfp423 UTSW 8 87782879 missense probably damaging 1.00
R7074:Zfp423 UTSW 8 87782432 missense probably benign 0.00
R7121:Zfp423 UTSW 8 87780861 missense probably damaging 1.00
R7242:Zfp423 UTSW 8 87904527 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CAGGGTATGCTTGTCTCCATATGG -3'
(R):5'- AAATTTGTAGGTTTTGTGCCCC -3'

Sequencing Primer
(F):5'- CCATATGGAATGAGTTTTACTGGCC -3'
(R):5'- GACCTGTGTCTTACCCCAT -3'
Posted On2016-02-04