Incidental Mutation 'R4818:Abhd5'
ID370006
Institutional Source Beutler Lab
Gene Symbol Abhd5
Ensembl Gene ENSMUSG00000032540
Gene Nameabhydrolase domain containing 5
SynonymsNCIE2, IECN5, 2010002J10Rik, CGI-58, 1300003D03Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.810) question?
Stock #R4818 (G1)
Quality Score204
Status Validated
Chromosome9
Chromosomal Location122351608-122381524 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 122363800 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035128] [ENSMUST00000111497] [ENSMUST00000154161] [ENSMUST00000156520] [ENSMUST00000175973]
Predicted Effect probably benign
Transcript: ENSMUST00000035128
Predicted Effect probably benign
Transcript: ENSMUST00000111497
SMART Domains Protein: ENSMUSP00000107123
Gene: ENSMUSG00000032540

DomainStartEndE-ValueType
Pfam:Abhydrolase_6 3 189 7.8e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000154161
SMART Domains Protein: ENSMUSP00000122939
Gene: ENSMUSG00000032540

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 36 127 1.4e-8 PFAM
Pfam:Abhydrolase_6 37 127 1.5e-18 PFAM
Pfam:Abhydrolase_1 61 127 2.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156520
SMART Domains Protein: ENSMUSP00000122274
Gene: ENSMUSG00000032540

DomainStartEndE-ValueType
Pfam:Hydrolase_4 75 246 4.1e-11 PFAM
Pfam:Abhydrolase_1 78 208 6e-20 PFAM
Pfam:Abhydrolase_5 79 330 6.7e-11 PFAM
Pfam:Abhydrolase_6 80 342 8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216775
Meta Mutation Damage Score 0.6276 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a large family of proteins defined by an alpha/beta hydrolase fold, and contains three sequence motifs that correspond to a catalytic triad found in the esterase/lipase/thioesterase subfamily. It differs from other members of this subfamily in that its putative catalytic triad contains an asparagine instead of the serine residue. Mutations in this gene have been associated with Chanarin-Dorfman syndrome, a triglyceride storage disease with impaired long-chain fatty acid oxidation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit growth retardation, impaired triacylglycerol catabolism, hepatic steatosis, and lethal skin barrier defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,741,466 E562G probably benign Het
5730522E02Rik A G 11: 25,770,472 probably null Het
A930033H14Rik A T 10: 69,212,360 probably benign Het
Abca17 C T 17: 24,317,161 E511K probably damaging Het
Abca9 C T 11: 110,155,154 probably null Het
Adra2b G A 2: 127,364,092 W171* probably null Het
Aldh1l1 T C 6: 90,596,915 Y799H probably benign Het
Arfgef1 A G 1: 10,216,547 V46A probably benign Het
Arhgap40 A G 2: 158,539,719 E374G probably damaging Het
Arhgef5 G A 6: 43,273,550 V412I probably benign Het
Arid3c T C 4: 41,730,072 E41G possibly damaging Het
Atp8b4 T A 2: 126,322,816 K1193N probably benign Het
C4a C T 17: 34,816,999 noncoding transcript Het
Chst2 C T 9: 95,405,364 D310N probably damaging Het
Crtc3 T C 7: 80,677,422 Q52R possibly damaging Het
Crybg1 T C 10: 43,998,587 I842V probably benign Het
Dennd4c T C 4: 86,825,274 S1167P probably benign Het
Edem3 T C 1: 151,792,385 V305A possibly damaging Het
Epha10 T A 4: 124,886,214 probably null Het
Epha6 C A 16: 59,654,063 R1117L probably damaging Het
Fdx1l T C 9: 21,067,864 I144V possibly damaging Het
Gm10762 C T 2: 128,967,186 W81* probably null Het
Gm14139 T A 2: 150,192,061 C132S probably damaging Het
Gm4737 G A 16: 46,154,192 T274I probably damaging Het
Hus1 A G 11: 8,996,808 probably benign Het
Igbp1b C T 6: 138,657,805 E214K probably benign Het
Inpp5f A G 7: 128,685,129 I577M probably damaging Het
Kansl2 G A 15: 98,526,661 T296I possibly damaging Het
Kcna6 A G 6: 126,738,424 F501L probably benign Het
Kirrel2 A T 7: 30,449,868 V579D probably benign Het
Larp1b T C 3: 40,970,570 Y208H probably damaging Het
Lipf A T 19: 33,965,688 D132V probably benign Het
Lsm12 T C 11: 102,167,163 K40E probably damaging Het
Mastl A G 2: 23,137,026 S275P probably benign Het
Mrpl44 A G 1: 79,780,977 I281V probably benign Het
Mtf1 T A 4: 124,804,712 M1K probably null Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myh2 G A 11: 67,176,255 G179R probably damaging Het
Nfasc T C 1: 132,603,830 T739A possibly damaging Het
Nfatc3 G A 8: 106,108,379 V778I probably benign Het
Notch4 A G 17: 34,578,716 probably benign Het
Npm2 T C 14: 70,652,402 N24S probably benign Het
Obox7 T A 7: 14,664,485 L108Q probably damaging Het
Olfr615 T A 7: 103,560,761 F95I probably benign Het
Pax3 A G 1: 78,132,232 V263A probably damaging Het
Pdlim1 C T 19: 40,223,136 V238I probably damaging Het
Pik3ip1 G A 11: 3,330,928 probably benign Het
Ptprq A G 10: 107,710,581 V284A possibly damaging Het
Rad9b G A 5: 122,339,776 T179I probably damaging Het
Rrnad1 C A 3: 87,924,998 R293L probably benign Het
Sirt4 G T 5: 115,479,726 D290E possibly damaging Het
Skint6 T A 4: 112,955,392 probably benign Het
Slc18a1 A C 8: 69,040,299 I466S probably damaging Het
Slc35e4 C T 11: 3,912,889 R100H probably benign Het
Sptbn5 T G 2: 120,067,968 K470Q probably benign Het
Tas1r1 C G 4: 152,032,674 V168L probably benign Het
Tmem233 T A 5: 116,083,163 Q8L possibly damaging Het
Ttc17 G T 2: 94,332,891 Q862K possibly damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp229 T C 17: 21,743,904 I68T probably benign Het
Zfp423 A G 8: 87,904,500 V30A probably benign Het
Other mutations in Abhd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Abhd5 APN 9 122368081 missense possibly damaging 0.73
IGL02143:Abhd5 APN 9 122365213 start codon destroyed probably null 0.01
IGL02949:Abhd5 APN 9 122377915 missense possibly damaging 0.51
IGL03248:Abhd5 APN 9 122368225 missense probably damaging 1.00
R0363:Abhd5 UTSW 9 122368146 missense possibly damaging 0.61
R1519:Abhd5 UTSW 9 122379014 splice site probably null
R2108:Abhd5 UTSW 9 122377940 missense probably damaging 1.00
R5048:Abhd5 UTSW 9 122377903 missense probably damaging 1.00
R5786:Abhd5 UTSW 9 122363803 splice site probably null
R6141:Abhd5 UTSW 9 122377933 missense probably benign 0.01
R6901:Abhd5 UTSW 9 122368155 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GTTTGTAAAGTTCTTGCCTCACAG -3'
(R):5'- GCTGGTGTGCATAGAGAAGC -3'

Sequencing Primer
(F):5'- TAAAGTTCTTGCCTCACAGGACCTAG -3'
(R):5'- AAAGGAGGCTTGCTCACTC -3'
Posted On2016-02-04