Incidental Mutation 'R4819:Kif18a'
ID370037
Institutional Source Beutler Lab
Gene Symbol Kif18a
Ensembl Gene ENSMUSG00000027115
Gene Namekinesin family member 18A
SynonymsB130001M12Rik, N-8 kinesin
MMRRC Submission 042000-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4819 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location109280738-109341747 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109292126 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 182 (D182G)
Ref Sequence ENSEMBL: ENSMUSP00000028527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028527]
Predicted Effect probably damaging
Transcript: ENSMUST00000028527
AA Change: D182G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028527
Gene: ENSMUSG00000027115
AA Change: D182G

DomainStartEndE-ValueType
KISc 9 363 8.91e-158 SMART
Blast:KISc 382 433 1e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130137
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152751
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162515
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] KIF18A is a member of the kinesin superfamily of microtubule-associated molecular motors (see MIM 148760) that use hydrolysis of ATP to produce force and movement along microtubules (Luboshits and Benayahu, 2005 [PubMed 15878648]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for loss of function alleles exhibit reduced female fertility and male infertility due to primordial germ cell depletion. The sterility phenotype is incompletely penetrant, has variable expressivity, and is modulated by strain background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,290,421 N761K possibly damaging Het
Adgrf3 T A 5: 30,198,444 L444F possibly damaging Het
Akap8 G A 17: 32,312,305 R378W probably damaging Het
Amotl2 C T 9: 102,730,071 R693W probably damaging Het
As3mt G T 19: 46,707,529 probably benign Het
Atp6v1e2 A G 17: 86,944,538 V144A probably benign Het
Bfar C T 16: 13,687,467 Q114* probably null Het
Casd1 C T 6: 4,621,225 A261V probably damaging Het
Ccdc36 A G 9: 108,406,678 V189A probably benign Het
Cd177 A T 7: 24,752,271 I440K probably damaging Het
Cfap54 G T 10: 92,836,477 Y2910* probably null Het
Csl A G 10: 99,758,082 F374L possibly damaging Het
Dctn1 G A 6: 83,190,519 R275H probably damaging Het
Derl3 A G 10: 75,893,879 probably null Het
Dst A G 1: 33,968,835 I117V probably benign Het
Edc3 T A 9: 57,748,397 C477S possibly damaging Het
Efs T C 14: 54,917,153 E450G probably damaging Het
Fcrla T A 1: 170,920,939 I212F probably damaging Het
Fsip2 A G 2: 82,988,442 I4840V probably benign Het
Gm14025 G T 2: 129,040,801 N98K probably damaging Het
Gpam T A 19: 55,078,341 I581F probably benign Het
Greb1l A G 18: 10,458,358 D45G probably damaging Het
Heca A G 10: 17,908,072 Y478H probably damaging Het
Hspa9 C T 18: 34,939,388 M561I probably damaging Het
Hyal6 T A 6: 24,734,966 Y299* probably null Het
Ik T A 18: 36,753,257 probably null Het
Khsrp A G 17: 57,023,360 S582P possibly damaging Het
Krt2 T C 15: 101,811,544 T564A unknown Het
Lig4 A G 8: 9,971,885 S632P probably benign Het
Med1 C T 11: 98,155,432 probably benign Het
Mgat3 T A 15: 80,212,349 I459N probably damaging Het
Mkln1 A T 6: 31,474,486 Q454L probably benign Het
Mn1 A G 5: 111,419,937 E591G possibly damaging Het
Myo5c T A 9: 75,292,202 L1364Q probably damaging Het
Oas1d T C 5: 120,915,717 V80A probably damaging Het
Obscn A T 11: 59,038,848 D5180E probably damaging Het
Pax6 G A 2: 105,692,277 probably null Het
Pcdh15 A C 10: 74,324,389 N446T probably damaging Het
Pcnx2 A T 8: 125,855,230 F922L probably benign Het
Ptpn4 G T 1: 119,659,850 T921K probably benign Het
Selenov A G 7: 28,290,321 probably null Het
Tmem100 A G 11: 90,035,445 T33A probably benign Het
Tmem59 C T 4: 107,187,681 Q66* probably null Het
Trav21-dv12 T A 14: 53,876,613 Y63* probably null Het
Trim66 G T 7: 109,457,586 H1121Q probably damaging Het
Trim80 A G 11: 115,447,943 Y533C probably damaging Het
Ttc17 G A 2: 94,364,610 P520L probably damaging Het
Ttn A T 2: 76,791,749 V15483E probably damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfhx4 C A 3: 5,403,914 T3069K probably benign Het
Zfp281 A G 1: 136,625,710 H142R probably benign Het
Zfp462 G T 4: 55,060,044 R1190L probably damaging Het
Zfp935 T A 13: 62,454,417 H323L probably damaging Het
Other mutations in Kif18a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Kif18a APN 2 109317988 missense possibly damaging 0.93
IGL00795:Kif18a APN 2 109293020 missense probably damaging 1.00
IGL00904:Kif18a APN 2 109292126 missense probably damaging 1.00
IGL00990:Kif18a APN 2 109334422 missense probably benign 0.01
IGL01323:Kif18a APN 2 109298442 missense probably benign 0.02
IGL01382:Kif18a APN 2 109296766 nonsense probably null
IGL02205:Kif18a APN 2 109307018 splice site probably benign
IGL02207:Kif18a APN 2 109296707 missense probably damaging 0.99
IGL02970:Kif18a APN 2 109287888 missense probably damaging 1.00
IGL03087:Kif18a APN 2 109318117 splice site probably benign
R0030:Kif18a UTSW 2 109333318 missense probably benign
R0482:Kif18a UTSW 2 109287843 start codon destroyed probably null 1.00
R0631:Kif18a UTSW 2 109298322 splice site probably benign
R1597:Kif18a UTSW 2 109292991 missense probably damaging 1.00
R1640:Kif18a UTSW 2 109289816 missense probably benign 0.25
R1675:Kif18a UTSW 2 109298403 missense probably benign
R1723:Kif18a UTSW 2 109302882 missense probably damaging 1.00
R2141:Kif18a UTSW 2 109333503 missense probably benign 0.43
R2142:Kif18a UTSW 2 109333503 missense probably benign 0.43
R2243:Kif18a UTSW 2 109298107 missense probably damaging 1.00
R3609:Kif18a UTSW 2 109338596 missense probably benign 0.02
R3611:Kif18a UTSW 2 109338596 missense probably benign 0.02
R3882:Kif18a UTSW 2 109306974 missense probably benign 0.01
R4292:Kif18a UTSW 2 109298126 missense probably damaging 0.99
R4293:Kif18a UTSW 2 109293053 missense probably benign
R4294:Kif18a UTSW 2 109293053 missense probably benign
R4295:Kif18a UTSW 2 109293053 missense probably benign
R4428:Kif18a UTSW 2 109288121 missense probably damaging 1.00
R4791:Kif18a UTSW 2 109287875 missense probably benign 0.16
R5078:Kif18a UTSW 2 109295142 splice site probably benign
R5175:Kif18a UTSW 2 109302978 splice site probably null
R5319:Kif18a UTSW 2 109318025 missense probably benign 0.00
R5821:Kif18a UTSW 2 109289845 splice site probably benign
R5966:Kif18a UTSW 2 109292066 missense probably damaging 1.00
R6886:Kif18a UTSW 2 109296663 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGATCACAATCTGTTCTGCAG -3'
(R):5'- TGACCCTGGATAGTCACTCAG -3'

Sequencing Primer
(F):5'- CACAATCTGTTCTGCAGTTGTG -3'
(R):5'- GATAGTCACTCAGGGCTTTAGATCC -3'
Posted On2016-02-04