Incidental Mutation 'R4819:Mkln1'
ID370049
Institutional Source Beutler Lab
Gene Symbol Mkln1
Ensembl Gene ENSMUSG00000025609
Gene Namemuskelin 1, intracellular mediator containing kelch motifs
Synonyms
MMRRC Submission 042000-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.326) question?
Stock #R4819 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location31398735-31516811 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31474486 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 454 (Q454L)
Ref Sequence ENSEMBL: ENSMUSP00000026699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026699]
PDB Structure
The crystal structure of discoidin domain from muskelin [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000026699
AA Change: Q454L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000026699
Gene: ENSMUSG00000025609
AA Change: Q454L

DomainStartEndE-ValueType
Pfam:F5_F8_type_C 20 150 5.8e-11 PFAM
LisH 172 204 4.68e-3 SMART
CTLH 206 258 5.29e-2 SMART
Pfam:Kelch_4 270 324 5.8e-7 PFAM
Pfam:Kelch_1 279 315 2.2e-8 PFAM
Pfam:Kelch_3 282 334 7.6e-13 PFAM
Pfam:Kelch_1 459 498 2.8e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141045
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147614
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150949
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200915
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Muskelin is an intracellular protein that acts as a mediator of cell spreading and cytoskeletal responses to the extracellular matrix component thrombospondin I (MIM 188060) (Adams et al., 1998 [PubMed 9724633]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit abnormal high-frequency ripple oscillation associated with GABA receptor internalization, intracellular trafficking, and degradation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,290,421 N761K possibly damaging Het
Adgrf3 T A 5: 30,198,444 L444F possibly damaging Het
Akap8 G A 17: 32,312,305 R378W probably damaging Het
Amotl2 C T 9: 102,730,071 R693W probably damaging Het
As3mt G T 19: 46,707,529 probably benign Het
Atp6v1e2 A G 17: 86,944,538 V144A probably benign Het
Bfar C T 16: 13,687,467 Q114* probably null Het
Casd1 C T 6: 4,621,225 A261V probably damaging Het
Ccdc36 A G 9: 108,406,678 V189A probably benign Het
Cd177 A T 7: 24,752,271 I440K probably damaging Het
Cfap54 G T 10: 92,836,477 Y2910* probably null Het
Csl A G 10: 99,758,082 F374L possibly damaging Het
Dctn1 G A 6: 83,190,519 R275H probably damaging Het
Derl3 A G 10: 75,893,879 probably null Het
Dst A G 1: 33,968,835 I117V probably benign Het
Edc3 T A 9: 57,748,397 C477S possibly damaging Het
Efs T C 14: 54,917,153 E450G probably damaging Het
Fcrla T A 1: 170,920,939 I212F probably damaging Het
Fsip2 A G 2: 82,988,442 I4840V probably benign Het
Gm14025 G T 2: 129,040,801 N98K probably damaging Het
Gpam T A 19: 55,078,341 I581F probably benign Het
Greb1l A G 18: 10,458,358 D45G probably damaging Het
Heca A G 10: 17,908,072 Y478H probably damaging Het
Hspa9 C T 18: 34,939,388 M561I probably damaging Het
Hyal6 T A 6: 24,734,966 Y299* probably null Het
Ik T A 18: 36,753,257 probably null Het
Khsrp A G 17: 57,023,360 S582P possibly damaging Het
Kif18a A G 2: 109,292,126 D182G probably damaging Het
Krt2 T C 15: 101,811,544 T564A unknown Het
Lig4 A G 8: 9,971,885 S632P probably benign Het
Med1 C T 11: 98,155,432 probably benign Het
Mgat3 T A 15: 80,212,349 I459N probably damaging Het
Mn1 A G 5: 111,419,937 E591G possibly damaging Het
Myo5c T A 9: 75,292,202 L1364Q probably damaging Het
Oas1d T C 5: 120,915,717 V80A probably damaging Het
Obscn A T 11: 59,038,848 D5180E probably damaging Het
Pax6 G A 2: 105,692,277 probably null Het
Pcdh15 A C 10: 74,324,389 N446T probably damaging Het
Pcnx2 A T 8: 125,855,230 F922L probably benign Het
Ptpn4 G T 1: 119,659,850 T921K probably benign Het
Selenov A G 7: 28,290,321 probably null Het
Tmem100 A G 11: 90,035,445 T33A probably benign Het
Tmem59 C T 4: 107,187,681 Q66* probably null Het
Trav21-dv12 T A 14: 53,876,613 Y63* probably null Het
Trim66 G T 7: 109,457,586 H1121Q probably damaging Het
Trim80 A G 11: 115,447,943 Y533C probably damaging Het
Ttc17 G A 2: 94,364,610 P520L probably damaging Het
Ttn A T 2: 76,791,749 V15483E probably damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfhx4 C A 3: 5,403,914 T3069K probably benign Het
Zfp281 A G 1: 136,625,710 H142R probably benign Het
Zfp462 G T 4: 55,060,044 R1190L probably damaging Het
Zfp935 T A 13: 62,454,417 H323L probably damaging Het
Other mutations in Mkln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Mkln1 APN 6 31432990 missense probably damaging 0.99
IGL01569:Mkln1 APN 6 31428128 splice site probably benign
IGL01882:Mkln1 APN 6 31451534 missense probably benign
IGL02009:Mkln1 APN 6 31449520 missense probably benign 0.02
IGL02160:Mkln1 APN 6 31492791 splice site probably benign
IGL02994:Mkln1 APN 6 31490443 missense probably damaging 1.00
IGL03105:Mkln1 APN 6 31459059 nonsense probably null
R0376:Mkln1 UTSW 6 31478018 missense probably benign 0.00
R0446:Mkln1 UTSW 6 31449504 missense probably damaging 0.98
R0518:Mkln1 UTSW 6 31468132 missense probably benign 0.00
R0600:Mkln1 UTSW 6 31432927 splice site probably benign
R1066:Mkln1 UTSW 6 31418987 missense possibly damaging 0.85
R1248:Mkln1 UTSW 6 31489368 missense probably damaging 1.00
R1717:Mkln1 UTSW 6 31507644 missense probably benign
R1921:Mkln1 UTSW 6 31428178 missense probably benign 0.22
R1978:Mkln1 UTSW 6 31490530 nonsense probably null
R3836:Mkln1 UTSW 6 31468336 missense probably damaging 1.00
R3895:Mkln1 UTSW 6 31507667 missense probably damaging 1.00
R4456:Mkln1 UTSW 6 31426772 missense probably damaging 1.00
R4513:Mkln1 UTSW 6 31433158 intron probably benign
R4737:Mkln1 UTSW 6 31426799 missense probably damaging 1.00
R4960:Mkln1 UTSW 6 31459006 missense probably damaging 1.00
R5291:Mkln1 UTSW 6 31490481 missense possibly damaging 0.78
R5364:Mkln1 UTSW 6 31496712 missense probably damaging 1.00
R5739:Mkln1 UTSW 6 31496702 missense probably benign 0.00
R5797:Mkln1 UTSW 6 31433069 missense probably benign 0.21
R5890:Mkln1 UTSW 6 31490547 missense probably benign 0.02
R5940:Mkln1 UTSW 6 31489372 missense probably damaging 1.00
R6132:Mkln1 UTSW 6 31431220 missense probably damaging 0.98
R6521:Mkln1 UTSW 6 31490544 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTTACAGATGTGTATGGACTCAG -3'
(R):5'- CGGTATCTTCAGGAGTTTGTAAGC -3'

Sequencing Primer
(F):5'- CAGATGTGTATGGACTCAGAAAAAC -3'
(R):5'- GGAAATGACTAAGGGACAACTCACTC -3'
Posted On2016-02-04