Incidental Mutation 'R4819:Zdhhc1'
ID370055
Institutional Source Beutler Lab
Gene Symbol Zdhhc1
Ensembl Gene ENSMUSG00000039199
Gene Namezinc finger, DHHC domain containing 1
Synonyms
MMRRC Submission 042000-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4819 (G1)
Quality Score102
Status Not validated
Chromosome8
Chromosomal Location105472423-105496902 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CGGGGG to CGGGGGG at 105483744 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044286] [ENSMUST00000212303]
Predicted Effect probably null
Transcript: ENSMUST00000044286
SMART Domains Protein: ENSMUSP00000036471
Gene: ENSMUSG00000039199

DomainStartEndE-ValueType
transmembrane domain 49 71 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
Pfam:zf-DHHC 126 282 2.5e-38 PFAM
low complexity region 359 371 N/A INTRINSIC
low complexity region 383 392 N/A INTRINSIC
low complexity region 395 411 N/A INTRINSIC
low complexity region 414 426 N/A INTRINSIC
low complexity region 468 482 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212109
Predicted Effect probably null
Transcript: ENSMUST00000212303
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212538
Meta Mutation Damage Score 0.6096 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,290,421 N761K possibly damaging Het
Adgrf3 T A 5: 30,198,444 L444F possibly damaging Het
Akap8 G A 17: 32,312,305 R378W probably damaging Het
Amotl2 C T 9: 102,730,071 R693W probably damaging Het
As3mt G T 19: 46,707,529 probably benign Het
Atp6v1e2 A G 17: 86,944,538 V144A probably benign Het
Bfar C T 16: 13,687,467 Q114* probably null Het
Casd1 C T 6: 4,621,225 A261V probably damaging Het
Ccdc36 A G 9: 108,406,678 V189A probably benign Het
Cd177 A T 7: 24,752,271 I440K probably damaging Het
Cfap54 G T 10: 92,836,477 Y2910* probably null Het
Csl A G 10: 99,758,082 F374L possibly damaging Het
Dctn1 G A 6: 83,190,519 R275H probably damaging Het
Derl3 A G 10: 75,893,879 probably null Het
Dst A G 1: 33,968,835 I117V probably benign Het
Edc3 T A 9: 57,748,397 C477S possibly damaging Het
Efs T C 14: 54,917,153 E450G probably damaging Het
Fcrla T A 1: 170,920,939 I212F probably damaging Het
Fsip2 A G 2: 82,988,442 I4840V probably benign Het
Gm14025 G T 2: 129,040,801 N98K probably damaging Het
Gpam T A 19: 55,078,341 I581F probably benign Het
Greb1l A G 18: 10,458,358 D45G probably damaging Het
Heca A G 10: 17,908,072 Y478H probably damaging Het
Hspa9 C T 18: 34,939,388 M561I probably damaging Het
Hyal6 T A 6: 24,734,966 Y299* probably null Het
Ik T A 18: 36,753,257 probably null Het
Khsrp A G 17: 57,023,360 S582P possibly damaging Het
Kif18a A G 2: 109,292,126 D182G probably damaging Het
Krt2 T C 15: 101,811,544 T564A unknown Het
Lig4 A G 8: 9,971,885 S632P probably benign Het
Med1 C T 11: 98,155,432 probably benign Het
Mgat3 T A 15: 80,212,349 I459N probably damaging Het
Mkln1 A T 6: 31,474,486 Q454L probably benign Het
Mn1 A G 5: 111,419,937 E591G possibly damaging Het
Myo5c T A 9: 75,292,202 L1364Q probably damaging Het
Oas1d T C 5: 120,915,717 V80A probably damaging Het
Obscn A T 11: 59,038,848 D5180E probably damaging Het
Pax6 G A 2: 105,692,277 probably null Het
Pcdh15 A C 10: 74,324,389 N446T probably damaging Het
Pcnx2 A T 8: 125,855,230 F922L probably benign Het
Ptpn4 G T 1: 119,659,850 T921K probably benign Het
Selenov A G 7: 28,290,321 probably null Het
Tmem100 A G 11: 90,035,445 T33A probably benign Het
Tmem59 C T 4: 107,187,681 Q66* probably null Het
Trav21-dv12 T A 14: 53,876,613 Y63* probably null Het
Trim66 G T 7: 109,457,586 H1121Q probably damaging Het
Trim80 A G 11: 115,447,943 Y533C probably damaging Het
Ttc17 G A 2: 94,364,610 P520L probably damaging Het
Ttn A T 2: 76,791,749 V15483E probably damaging Het
Zfhx4 C A 3: 5,403,914 T3069K probably benign Het
Zfp281 A G 1: 136,625,710 H142R probably benign Het
Zfp462 G T 4: 55,060,044 R1190L probably damaging Het
Zfp935 T A 13: 62,454,417 H323L probably damaging Het
Other mutations in Zdhhc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Zdhhc1 APN 8 105472998 missense probably benign
hacked UTSW 8 105483744 frame shift probably null
R0329:Zdhhc1 UTSW 8 105483543 missense probably benign 0.04
R1898:Zdhhc1 UTSW 8 105478746 splice site probably null
R2511:Zdhhc1 UTSW 8 105483558 missense probably benign 0.16
R4734:Zdhhc1 UTSW 8 105483744 frame shift probably null
R4741:Zdhhc1 UTSW 8 105483744 frame shift probably null
R4795:Zdhhc1 UTSW 8 105483744 frame shift probably null
R4818:Zdhhc1 UTSW 8 105483744 frame shift probably null
R4822:Zdhhc1 UTSW 8 105483744 frame shift probably null
R4871:Zdhhc1 UTSW 8 105483744 frame shift probably null
R4891:Zdhhc1 UTSW 8 105473017 missense probably benign 0.00
R4901:Zdhhc1 UTSW 8 105472852 missense probably benign
R4905:Zdhhc1 UTSW 8 105483694 missense probably damaging 0.98
R4953:Zdhhc1 UTSW 8 105483744 frame shift probably null
R5128:Zdhhc1 UTSW 8 105483636 missense probably benign 0.02
R5274:Zdhhc1 UTSW 8 105483770 missense probably benign 0.30
R5380:Zdhhc1 UTSW 8 105483744 frame shift probably null
R5381:Zdhhc1 UTSW 8 105483744 frame shift probably null
R6852:Zdhhc1 UTSW 8 105477072 missense possibly damaging 0.70
R6962:Zdhhc1 UTSW 8 105483647 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAAGGATACAGCATAGCCAG -3'
(R):5'- AATTAGGCTAAGACCCCAGGTTTC -3'

Sequencing Primer
(F):5'- CCCAGTGGTGAGGCAAG -3'
(R):5'- TCCCTGCAGAGTGTATAGCC -3'
Posted On2016-02-04