Incidental Mutation 'R4819:Amotl2'
ID370059
Institutional Source Beutler Lab
Gene Symbol Amotl2
Ensembl Gene ENSMUSG00000032531
Gene Nameangiomotin-like 2
SynonymsLccp, MASCOT
MMRRC Submission 042000-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R4819 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location102716672-102733418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 102730071 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 693 (R693W)
Ref Sequence ENSEMBL: ENSMUSP00000121113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035121] [ENSMUST00000142011] [ENSMUST00000153965] [ENSMUST00000190047]
Predicted Effect probably damaging
Transcript: ENSMUST00000035121
AA Change: R660W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035121
Gene: ENSMUSG00000032531
AA Change: R660W

DomainStartEndE-ValueType
low complexity region 33 53 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
low complexity region 157 170 N/A INTRINSIC
low complexity region 192 215 N/A INTRINSIC
low complexity region 248 268 N/A INTRINSIC
Blast:PAC 352 393 1e-12 BLAST
low complexity region 422 436 N/A INTRINSIC
Pfam:Angiomotin_C 478 688 2.3e-98 PFAM
low complexity region 698 710 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126616
Predicted Effect unknown
Transcript: ENSMUST00000130602
AA Change: R474W
SMART Domains Protein: ENSMUSP00000115845
Gene: ENSMUSG00000032531
AA Change: R474W

DomainStartEndE-ValueType
low complexity region 30 50 N/A INTRINSIC
Blast:PAC 134 175 8e-13 BLAST
low complexity region 204 218 N/A INTRINSIC
Pfam:Angiomotin_C 260 470 4.9e-98 PFAM
low complexity region 480 492 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138224
Predicted Effect probably damaging
Transcript: ENSMUST00000142011
AA Change: R660W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120378
Gene: ENSMUSG00000032531
AA Change: R660W

DomainStartEndE-ValueType
low complexity region 33 53 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
low complexity region 157 170 N/A INTRINSIC
low complexity region 192 215 N/A INTRINSIC
low complexity region 248 268 N/A INTRINSIC
Blast:PAC 352 393 1e-12 BLAST
low complexity region 422 436 N/A INTRINSIC
Pfam:Angiomotin_C 478 686 1.2e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000153965
AA Change: R693W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121113
Gene: ENSMUSG00000032531
AA Change: R693W

DomainStartEndE-ValueType
low complexity region 66 86 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
low complexity region 190 203 N/A INTRINSIC
low complexity region 225 248 N/A INTRINSIC
low complexity region 281 301 N/A INTRINSIC
Blast:PAC 385 426 1e-12 BLAST
low complexity region 455 469 N/A INTRINSIC
Pfam:Angiomotin_C 511 719 3.7e-94 PFAM
low complexity region 731 743 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155143
Predicted Effect probably benign
Transcript: ENSMUST00000190047
SMART Domains Protein: ENSMUSP00000140688
Gene: ENSMUSG00000032531

DomainStartEndE-ValueType
coiled coil region 1 114 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiomotin is a protein that binds angiostatin, a circulating inhibitor of the formation of new blood vessels (angiogenesis). Angiomotin mediates angiostatin inhibition of endothelial cell migration and tube formation in vitro. The protein encoded by this gene is related to angiomotin and is a member of the motin protein family. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Conditional homozygous knockout in endothelial cells during embryonic development leads to aortic restriction in the embryo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,290,421 N761K possibly damaging Het
Adgrf3 T A 5: 30,198,444 L444F possibly damaging Het
Akap8 G A 17: 32,312,305 R378W probably damaging Het
As3mt G T 19: 46,707,529 probably benign Het
Atp6v1e2 A G 17: 86,944,538 V144A probably benign Het
Bfar C T 16: 13,687,467 Q114* probably null Het
Casd1 C T 6: 4,621,225 A261V probably damaging Het
Ccdc36 A G 9: 108,406,678 V189A probably benign Het
Cd177 A T 7: 24,752,271 I440K probably damaging Het
Cfap54 G T 10: 92,836,477 Y2910* probably null Het
Csl A G 10: 99,758,082 F374L possibly damaging Het
Dctn1 G A 6: 83,190,519 R275H probably damaging Het
Derl3 A G 10: 75,893,879 probably null Het
Dst A G 1: 33,968,835 I117V probably benign Het
Edc3 T A 9: 57,748,397 C477S possibly damaging Het
Efs T C 14: 54,917,153 E450G probably damaging Het
Fcrla T A 1: 170,920,939 I212F probably damaging Het
Fsip2 A G 2: 82,988,442 I4840V probably benign Het
Gm14025 G T 2: 129,040,801 N98K probably damaging Het
Gpam T A 19: 55,078,341 I581F probably benign Het
Greb1l A G 18: 10,458,358 D45G probably damaging Het
Heca A G 10: 17,908,072 Y478H probably damaging Het
Hspa9 C T 18: 34,939,388 M561I probably damaging Het
Hyal6 T A 6: 24,734,966 Y299* probably null Het
Ik T A 18: 36,753,257 probably null Het
Khsrp A G 17: 57,023,360 S582P possibly damaging Het
Kif18a A G 2: 109,292,126 D182G probably damaging Het
Krt2 T C 15: 101,811,544 T564A unknown Het
Lig4 A G 8: 9,971,885 S632P probably benign Het
Med1 C T 11: 98,155,432 probably benign Het
Mgat3 T A 15: 80,212,349 I459N probably damaging Het
Mkln1 A T 6: 31,474,486 Q454L probably benign Het
Mn1 A G 5: 111,419,937 E591G possibly damaging Het
Myo5c T A 9: 75,292,202 L1364Q probably damaging Het
Oas1d T C 5: 120,915,717 V80A probably damaging Het
Obscn A T 11: 59,038,848 D5180E probably damaging Het
Pax6 G A 2: 105,692,277 probably null Het
Pcdh15 A C 10: 74,324,389 N446T probably damaging Het
Pcnx2 A T 8: 125,855,230 F922L probably benign Het
Ptpn4 G T 1: 119,659,850 T921K probably benign Het
Selenov A G 7: 28,290,321 probably null Het
Tmem100 A G 11: 90,035,445 T33A probably benign Het
Tmem59 C T 4: 107,187,681 Q66* probably null Het
Trav21-dv12 T A 14: 53,876,613 Y63* probably null Het
Trim66 G T 7: 109,457,586 H1121Q probably damaging Het
Trim80 A G 11: 115,447,943 Y533C probably damaging Het
Ttc17 G A 2: 94,364,610 P520L probably damaging Het
Ttn A T 2: 76,791,749 V15483E probably damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfhx4 C A 3: 5,403,914 T3069K probably benign Het
Zfp281 A G 1: 136,625,710 H142R probably benign Het
Zfp462 G T 4: 55,060,044 R1190L probably damaging Het
Zfp935 T A 13: 62,454,417 H323L probably damaging Het
Other mutations in Amotl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Amotl2 APN 9 102725117 missense probably damaging 1.00
IGL02207:Amotl2 APN 9 102724697 missense probably damaging 1.00
R0471:Amotl2 UTSW 9 102720519 missense probably damaging 0.98
R1420:Amotl2 UTSW 9 102724783 missense possibly damaging 0.91
R1483:Amotl2 UTSW 9 102730897 missense probably benign 0.16
R1525:Amotl2 UTSW 9 102728568 missense probably damaging 1.00
R1661:Amotl2 UTSW 9 102730096 missense probably damaging 0.99
R1945:Amotl2 UTSW 9 102720554 missense probably benign
R2113:Amotl2 UTSW 9 102724723 nonsense probably null
R2157:Amotl2 UTSW 9 102730589 unclassified probably benign
R4084:Amotl2 UTSW 9 102724685 critical splice acceptor site probably null
R4726:Amotl2 UTSW 9 102723819 missense probably benign 0.00
R4755:Amotl2 UTSW 9 102720480 missense probably damaging 1.00
R4782:Amotl2 UTSW 9 102720123 critical splice donor site probably null
R5048:Amotl2 UTSW 9 102723798 missense probably benign 0.00
R5328:Amotl2 UTSW 9 102723768 missense probably benign
R5894:Amotl2 UTSW 9 102725172 missense possibly damaging 0.79
R6956:Amotl2 UTSW 9 102724768 missense probably damaging 1.00
X0022:Amotl2 UTSW 9 102729470 missense probably damaging 1.00
Z1088:Amotl2 UTSW 9 102723698 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGCAATAATAGGTGGGCTTCC -3'
(R):5'- ATGTAGGTTGCAGTCACGGG -3'

Sequencing Primer
(F):5'- TTCCAAGGCCAAGAGGTCCTG -3'
(R):5'- AGGAAGCCCTGGTCTCAGTG -3'
Posted On2016-02-04