Incidental Mutation 'R4819:Derl3'
ID370063
Institutional Source Beutler Lab
Gene Symbol Derl3
Ensembl Gene ENSMUSG00000009092
Gene NameDer1-like domain family, member 3
Synonyms1810063P04Rik, 1810006I20Rik, IZP6, derlin-3
MMRRC Submission 042000-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4819 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location75893413-75895941 bp(+) (GRCm38)
Type of Mutationintron (36 bp from exon)
DNA Base Change (assembly) A to G at 75893879 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000925] [ENSMUST00000009236] [ENSMUST00000121304] [ENSMUST00000140388] [ENSMUST00000217811]
Predicted Effect probably benign
Transcript: ENSMUST00000000925
SMART Domains Protein: ENSMUSP00000000925
Gene: ENSMUSG00000000902

DomainStartEndE-ValueType
Blast:HX 31 52 9e-8 BLAST
Pfam:SNF5 179 254 1.1e-27 PFAM
Pfam:SNF5 249 373 3.1e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000009236
SMART Domains Protein: ENSMUSP00000009236
Gene: ENSMUSG00000009092

DomainStartEndE-ValueType
Pfam:DER1 13 203 7.4e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121304
SMART Domains Protein: ENSMUSP00000112463
Gene: ENSMUSG00000000902

DomainStartEndE-ValueType
Blast:HX 31 52 9e-8 BLAST
Pfam:SNF5 169 364 1.7e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133189
Predicted Effect probably benign
Transcript: ENSMUST00000140388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140408
Predicted Effect probably null
Transcript: ENSMUST00000217811
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220190
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be involved in the degradation of misfolded glycoproteins in the ER. Several alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for this gene trapped allele show no obvious phenotype alterations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,290,421 N761K possibly damaging Het
Adgrf3 T A 5: 30,198,444 L444F possibly damaging Het
Akap8 G A 17: 32,312,305 R378W probably damaging Het
Amotl2 C T 9: 102,730,071 R693W probably damaging Het
As3mt G T 19: 46,707,529 probably benign Het
Atp6v1e2 A G 17: 86,944,538 V144A probably benign Het
Bfar C T 16: 13,687,467 Q114* probably null Het
Casd1 C T 6: 4,621,225 A261V probably damaging Het
Ccdc36 A G 9: 108,406,678 V189A probably benign Het
Cd177 A T 7: 24,752,271 I440K probably damaging Het
Cfap54 G T 10: 92,836,477 Y2910* probably null Het
Csl A G 10: 99,758,082 F374L possibly damaging Het
Dctn1 G A 6: 83,190,519 R275H probably damaging Het
Dst A G 1: 33,968,835 I117V probably benign Het
Edc3 T A 9: 57,748,397 C477S possibly damaging Het
Efs T C 14: 54,917,153 E450G probably damaging Het
Fcrla T A 1: 170,920,939 I212F probably damaging Het
Fsip2 A G 2: 82,988,442 I4840V probably benign Het
Gm14025 G T 2: 129,040,801 N98K probably damaging Het
Gpam T A 19: 55,078,341 I581F probably benign Het
Greb1l A G 18: 10,458,358 D45G probably damaging Het
Heca A G 10: 17,908,072 Y478H probably damaging Het
Hspa9 C T 18: 34,939,388 M561I probably damaging Het
Hyal6 T A 6: 24,734,966 Y299* probably null Het
Ik T A 18: 36,753,257 probably null Het
Khsrp A G 17: 57,023,360 S582P possibly damaging Het
Kif18a A G 2: 109,292,126 D182G probably damaging Het
Krt2 T C 15: 101,811,544 T564A unknown Het
Lig4 A G 8: 9,971,885 S632P probably benign Het
Med1 C T 11: 98,155,432 probably benign Het
Mgat3 T A 15: 80,212,349 I459N probably damaging Het
Mkln1 A T 6: 31,474,486 Q454L probably benign Het
Mn1 A G 5: 111,419,937 E591G possibly damaging Het
Myo5c T A 9: 75,292,202 L1364Q probably damaging Het
Oas1d T C 5: 120,915,717 V80A probably damaging Het
Obscn A T 11: 59,038,848 D5180E probably damaging Het
Pax6 G A 2: 105,692,277 probably null Het
Pcdh15 A C 10: 74,324,389 N446T probably damaging Het
Pcnx2 A T 8: 125,855,230 F922L probably benign Het
Ptpn4 G T 1: 119,659,850 T921K probably benign Het
Selenov A G 7: 28,290,321 probably null Het
Tmem100 A G 11: 90,035,445 T33A probably benign Het
Tmem59 C T 4: 107,187,681 Q66* probably null Het
Trav21-dv12 T A 14: 53,876,613 Y63* probably null Het
Trim66 G T 7: 109,457,586 H1121Q probably damaging Het
Trim80 A G 11: 115,447,943 Y533C probably damaging Het
Ttc17 G A 2: 94,364,610 P520L probably damaging Het
Ttn A T 2: 76,791,749 V15483E probably damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfhx4 C A 3: 5,403,914 T3069K probably benign Het
Zfp281 A G 1: 136,625,710 H142R probably benign Het
Zfp462 G T 4: 55,060,044 R1190L probably damaging Het
Zfp935 T A 13: 62,454,417 H323L probably damaging Het
Other mutations in Derl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02735:Derl3 APN 10 75895116 missense probably damaging 0.97
IGL03143:Derl3 APN 10 75894490 missense possibly damaging 0.90
R0730:Derl3 UTSW 10 75895242 splice site probably benign
R5524:Derl3 UTSW 10 75894490 missense possibly damaging 0.90
R6041:Derl3 UTSW 10 75893501 missense probably damaging 0.99
R6914:Derl3 UTSW 10 75894216 intron probably null
Predicted Primers PCR Primer
(F):5'- TGTTCCGGAAGTTCCAGGTG -3'
(R):5'- GGCGACTCTTTGGTCCAATAATAC -3'

Sequencing Primer
(F):5'- AAGTTCCAGGTGAGGCGGC -3'
(R):5'- GACTCTTTGGTCCAATAATACTGAAC -3'
Posted On2016-02-04