Incidental Mutation 'R4819:Hspa9'
ID370084
Institutional Source Beutler Lab
Gene Symbol Hspa9
Ensembl Gene ENSMUSG00000024359
Gene Nameheat shock protein 9
SynonymsC3H-specific antigen, mthsp70, GRP75, PBP74, CSA, Hsc74, mot-2, Hsp74a, Hspa9a, Hsp74, mortalin
MMRRC Submission 042000-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R4819 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location34937414-34954357 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34939388 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 561 (M561I)
Ref Sequence ENSEMBL: ENSMUSP00000025217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025217]
Predicted Effect probably damaging
Transcript: ENSMUST00000025217
AA Change: M561I

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025217
Gene: ENSMUSG00000024359
AA Change: M561I

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
Pfam:HSP70 55 653 2.7e-270 PFAM
Pfam:FGGY_C 283 429 3e-8 PFAM
low complexity region 657 679 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158614
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172829
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173701
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heat shock protein 70 gene family. The encoded protein is primarily localized to the mitochondria but is also found in the endoplasmic reticulum, plasma membrane and cytoplasmic vesicles. This protein is a heat-shock cognate protein. This protein plays a role in cell proliferation, stress response and maintenance of the mitochondria. A pseudogene of this gene is found on chromosome 2.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality while heterozygotes display decreased pre-B cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,290,421 N761K possibly damaging Het
Adgrf3 T A 5: 30,198,444 L444F possibly damaging Het
Akap8 G A 17: 32,312,305 R378W probably damaging Het
Amotl2 C T 9: 102,730,071 R693W probably damaging Het
As3mt G T 19: 46,707,529 probably benign Het
Atp6v1e2 A G 17: 86,944,538 V144A probably benign Het
Bfar C T 16: 13,687,467 Q114* probably null Het
Casd1 C T 6: 4,621,225 A261V probably damaging Het
Ccdc36 A G 9: 108,406,678 V189A probably benign Het
Cd177 A T 7: 24,752,271 I440K probably damaging Het
Cfap54 G T 10: 92,836,477 Y2910* probably null Het
Csl A G 10: 99,758,082 F374L possibly damaging Het
Dctn1 G A 6: 83,190,519 R275H probably damaging Het
Derl3 A G 10: 75,893,879 probably null Het
Dst A G 1: 33,968,835 I117V probably benign Het
Edc3 T A 9: 57,748,397 C477S possibly damaging Het
Efs T C 14: 54,917,153 E450G probably damaging Het
Fcrla T A 1: 170,920,939 I212F probably damaging Het
Fsip2 A G 2: 82,988,442 I4840V probably benign Het
Gm14025 G T 2: 129,040,801 N98K probably damaging Het
Gpam T A 19: 55,078,341 I581F probably benign Het
Greb1l A G 18: 10,458,358 D45G probably damaging Het
Heca A G 10: 17,908,072 Y478H probably damaging Het
Hyal6 T A 6: 24,734,966 Y299* probably null Het
Ik T A 18: 36,753,257 probably null Het
Khsrp A G 17: 57,023,360 S582P possibly damaging Het
Kif18a A G 2: 109,292,126 D182G probably damaging Het
Krt2 T C 15: 101,811,544 T564A unknown Het
Lig4 A G 8: 9,971,885 S632P probably benign Het
Med1 C T 11: 98,155,432 probably benign Het
Mgat3 T A 15: 80,212,349 I459N probably damaging Het
Mkln1 A T 6: 31,474,486 Q454L probably benign Het
Mn1 A G 5: 111,419,937 E591G possibly damaging Het
Myo5c T A 9: 75,292,202 L1364Q probably damaging Het
Oas1d T C 5: 120,915,717 V80A probably damaging Het
Obscn A T 11: 59,038,848 D5180E probably damaging Het
Pax6 G A 2: 105,692,277 probably null Het
Pcdh15 A C 10: 74,324,389 N446T probably damaging Het
Pcnx2 A T 8: 125,855,230 F922L probably benign Het
Ptpn4 G T 1: 119,659,850 T921K probably benign Het
Selenov A G 7: 28,290,321 probably null Het
Tmem100 A G 11: 90,035,445 T33A probably benign Het
Tmem59 C T 4: 107,187,681 Q66* probably null Het
Trav21-dv12 T A 14: 53,876,613 Y63* probably null Het
Trim66 G T 7: 109,457,586 H1121Q probably damaging Het
Trim80 A G 11: 115,447,943 Y533C probably damaging Het
Ttc17 G A 2: 94,364,610 P520L probably damaging Het
Ttn A T 2: 76,791,749 V15483E probably damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfhx4 C A 3: 5,403,914 T3069K probably benign Het
Zfp281 A G 1: 136,625,710 H142R probably benign Het
Zfp462 G T 4: 55,060,044 R1190L probably damaging Het
Zfp935 T A 13: 62,454,417 H323L probably damaging Het
Other mutations in Hspa9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Hspa9 APN 18 34938580 splice site probably benign
IGL01939:Hspa9 APN 18 34938708 missense possibly damaging 0.89
IGL02008:Hspa9 APN 18 34947975 nonsense probably null
IGL02604:Hspa9 APN 18 34954213 missense unknown
Chiri-san UTSW 18 34939423 missense probably damaging 1.00
R0238:Hspa9 UTSW 18 34946646 nonsense probably null
R0238:Hspa9 UTSW 18 34946646 nonsense probably null
R0278:Hspa9 UTSW 18 34940910 missense possibly damaging 0.50
R0613:Hspa9 UTSW 18 34947980 missense probably damaging 1.00
R1414:Hspa9 UTSW 18 34938591 missense probably damaging 1.00
R1454:Hspa9 UTSW 18 34938606 missense probably damaging 1.00
R2013:Hspa9 UTSW 18 34946648 missense probably damaging 1.00
R2014:Hspa9 UTSW 18 34946648 missense probably damaging 1.00
R2015:Hspa9 UTSW 18 34946648 missense probably damaging 1.00
R2936:Hspa9 UTSW 18 34948014 missense probably damaging 1.00
R4261:Hspa9 UTSW 18 34939423 missense probably damaging 1.00
R4622:Hspa9 UTSW 18 34949037 missense possibly damaging 0.48
R5056:Hspa9 UTSW 18 34938681 missense probably damaging 1.00
R5223:Hspa9 UTSW 18 34952671 splice site probably null
R5666:Hspa9 UTSW 18 34954247 missense probably null
R5820:Hspa9 UTSW 18 34943174 missense possibly damaging 0.82
R5944:Hspa9 UTSW 18 34949023 missense possibly damaging 0.94
R6460:Hspa9 UTSW 18 34952712 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAGGTTGTCTCAAACACCC -3'
(R):5'- TGCTTAGAAGAAGATCACGTGAAC -3'

Sequencing Primer
(F):5'- GGTTGTCTCAAACACCCTGACTAC -3'
(R):5'- CTCAGTGCAGTAAGAGAACT -3'
Posted On2016-02-04