Incidental Mutation 'R4819:Ik'
ID370085
Institutional Source Beutler Lab
Gene Symbol Ik
Ensembl Gene ENSMUSG00000024474
Gene NameIK cytokine
SynonymsMuRED
MMRRC Submission 042000-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R4819 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location36744656-36757639 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 36753257 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000007042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007042]
Predicted Effect probably null
Transcript: ENSMUST00000007042
SMART Domains Protein: ENSMUSP00000007042
Gene: ENSMUSG00000024474

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:RED_N 76 302 1.6e-105 PFAM
low complexity region 334 380 N/A INTRINSIC
Pfam:RED_C 445 554 1.1e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224284
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified by its RED repeat, a stretch of repeated arginine, glutamic acid and aspartic acid residues. The protein localizes to discrete dots within the nucleus, excluding the nucleolus. Its function is unknown. This gene maps to chromosome 5; however, a pseudogene may exist on chromosome 2. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,290,421 N761K possibly damaging Het
Adgrf3 T A 5: 30,198,444 L444F possibly damaging Het
Akap8 G A 17: 32,312,305 R378W probably damaging Het
Amotl2 C T 9: 102,730,071 R693W probably damaging Het
As3mt G T 19: 46,707,529 probably benign Het
Atp6v1e2 A G 17: 86,944,538 V144A probably benign Het
Bfar C T 16: 13,687,467 Q114* probably null Het
Casd1 C T 6: 4,621,225 A261V probably damaging Het
Ccdc36 A G 9: 108,406,678 V189A probably benign Het
Cd177 A T 7: 24,752,271 I440K probably damaging Het
Cfap54 G T 10: 92,836,477 Y2910* probably null Het
Csl A G 10: 99,758,082 F374L possibly damaging Het
Dctn1 G A 6: 83,190,519 R275H probably damaging Het
Derl3 A G 10: 75,893,879 probably null Het
Dst A G 1: 33,968,835 I117V probably benign Het
Edc3 T A 9: 57,748,397 C477S possibly damaging Het
Efs T C 14: 54,917,153 E450G probably damaging Het
Fcrla T A 1: 170,920,939 I212F probably damaging Het
Fsip2 A G 2: 82,988,442 I4840V probably benign Het
Gm14025 G T 2: 129,040,801 N98K probably damaging Het
Gpam T A 19: 55,078,341 I581F probably benign Het
Greb1l A G 18: 10,458,358 D45G probably damaging Het
Heca A G 10: 17,908,072 Y478H probably damaging Het
Hspa9 C T 18: 34,939,388 M561I probably damaging Het
Hyal6 T A 6: 24,734,966 Y299* probably null Het
Khsrp A G 17: 57,023,360 S582P possibly damaging Het
Kif18a A G 2: 109,292,126 D182G probably damaging Het
Krt2 T C 15: 101,811,544 T564A unknown Het
Lig4 A G 8: 9,971,885 S632P probably benign Het
Med1 C T 11: 98,155,432 probably benign Het
Mgat3 T A 15: 80,212,349 I459N probably damaging Het
Mkln1 A T 6: 31,474,486 Q454L probably benign Het
Mn1 A G 5: 111,419,937 E591G possibly damaging Het
Myo5c T A 9: 75,292,202 L1364Q probably damaging Het
Oas1d T C 5: 120,915,717 V80A probably damaging Het
Obscn A T 11: 59,038,848 D5180E probably damaging Het
Pax6 G A 2: 105,692,277 probably null Het
Pcdh15 A C 10: 74,324,389 N446T probably damaging Het
Pcnx2 A T 8: 125,855,230 F922L probably benign Het
Ptpn4 G T 1: 119,659,850 T921K probably benign Het
Selenov A G 7: 28,290,321 probably null Het
Tmem100 A G 11: 90,035,445 T33A probably benign Het
Tmem59 C T 4: 107,187,681 Q66* probably null Het
Trav21-dv12 T A 14: 53,876,613 Y63* probably null Het
Trim66 G T 7: 109,457,586 H1121Q probably damaging Het
Trim80 A G 11: 115,447,943 Y533C probably damaging Het
Ttc17 G A 2: 94,364,610 P520L probably damaging Het
Ttn A T 2: 76,791,749 V15483E probably damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfhx4 C A 3: 5,403,914 T3069K probably benign Het
Zfp281 A G 1: 136,625,710 H142R probably benign Het
Zfp462 G T 4: 55,060,044 R1190L probably damaging Het
Zfp935 T A 13: 62,454,417 H323L probably damaging Het
Other mutations in Ik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00536:Ik APN 18 36756868 nonsense probably null
IGL01409:Ik APN 18 36756921 missense probably damaging 1.00
IGL01636:Ik APN 18 36751201 missense possibly damaging 0.63
IGL02282:Ik APN 18 36745644 missense probably damaging 0.99
IGL02422:Ik APN 18 36753260 critical splice acceptor site probably null
IGL03263:Ik APN 18 36748646 missense probably damaging 0.98
IGL03356:Ik APN 18 36756604 missense probably damaging 1.00
R0675:Ik UTSW 18 36747333 unclassified probably benign
R1778:Ik UTSW 18 36756818 unclassified probably benign
R4060:Ik UTSW 18 36748890 missense probably damaging 0.96
R4606:Ik UTSW 18 36753555 missense possibly damaging 0.68
R4684:Ik UTSW 18 36752414 missense probably damaging 1.00
R4978:Ik UTSW 18 36747415 missense possibly damaging 0.54
R5256:Ik UTSW 18 36748873 missense probably benign 0.00
R5751:Ik UTSW 18 36753513 missense probably benign 0.07
R5966:Ik UTSW 18 36755478 missense possibly damaging 0.50
R6378:Ik UTSW 18 36757288 missense probably damaging 1.00
R6952:Ik UTSW 18 36753560 missense probably damaging 1.00
Z1088:Ik UTSW 18 36744782 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGGGTTTGAAGCATCAAGGAG -3'
(R):5'- TGGGAAAACCAGGTTCCAC -3'

Sequencing Primer
(F):5'- TACCAGGTACATATGTGGTGCAC -3'
(R):5'- TGGGAAAACCAGGTTCCACTAATTG -3'
Posted On2016-02-04