Incidental Mutation 'R4819:Gpam'
ID370087
Institutional Source Beutler Lab
Gene Symbol Gpam
Ensembl Gene ENSMUSG00000024978
Gene Nameglycerol-3-phosphate acyltransferase, mitochondrial
SynonymsGPAT1
MMRRC Submission 042000-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.328) question?
Stock #R4819 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location55069734-55099451 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55078341 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 581 (I581F)
Ref Sequence ENSEMBL: ENSMUSP00000057635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061856]
Predicted Effect probably benign
Transcript: ENSMUST00000061856
AA Change: I581F

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000057635
Gene: ENSMUSG00000024978
AA Change: I581F

DomainStartEndE-ValueType
Blast:PlsC 5 34 3e-8 BLAST
PlsC 224 357 2.46e-23 SMART
Blast:PlsC 499 551 8e-27 BLAST
low complexity region 687 699 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial enzyme which prefers saturated fatty acids as its substrate for the synthesis of glycerolipids. This metabolic pathway's first step is catalyzed by the encoded enzyme. Two forms for this enzyme exist, one in the mitochondria and one in the endoplasmic reticulum. Two alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutant mice weighed less than controls and showed reduced triacylglycerol levels in the liver and plasma. The glycerolipid fatty acid composition is also disrupted in mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,290,421 N761K possibly damaging Het
Adgrf3 T A 5: 30,198,444 L444F possibly damaging Het
Akap8 G A 17: 32,312,305 R378W probably damaging Het
Amotl2 C T 9: 102,730,071 R693W probably damaging Het
As3mt G T 19: 46,707,529 probably benign Het
Atp6v1e2 A G 17: 86,944,538 V144A probably benign Het
Bfar C T 16: 13,687,467 Q114* probably null Het
Casd1 C T 6: 4,621,225 A261V probably damaging Het
Ccdc36 A G 9: 108,406,678 V189A probably benign Het
Cd177 A T 7: 24,752,271 I440K probably damaging Het
Cfap54 G T 10: 92,836,477 Y2910* probably null Het
Csl A G 10: 99,758,082 F374L possibly damaging Het
Dctn1 G A 6: 83,190,519 R275H probably damaging Het
Derl3 A G 10: 75,893,879 probably null Het
Dst A G 1: 33,968,835 I117V probably benign Het
Edc3 T A 9: 57,748,397 C477S possibly damaging Het
Efs T C 14: 54,917,153 E450G probably damaging Het
Fcrla T A 1: 170,920,939 I212F probably damaging Het
Fsip2 A G 2: 82,988,442 I4840V probably benign Het
Gm14025 G T 2: 129,040,801 N98K probably damaging Het
Greb1l A G 18: 10,458,358 D45G probably damaging Het
Heca A G 10: 17,908,072 Y478H probably damaging Het
Hspa9 C T 18: 34,939,388 M561I probably damaging Het
Hyal6 T A 6: 24,734,966 Y299* probably null Het
Ik T A 18: 36,753,257 probably null Het
Khsrp A G 17: 57,023,360 S582P possibly damaging Het
Kif18a A G 2: 109,292,126 D182G probably damaging Het
Krt2 T C 15: 101,811,544 T564A unknown Het
Lig4 A G 8: 9,971,885 S632P probably benign Het
Med1 C T 11: 98,155,432 probably benign Het
Mgat3 T A 15: 80,212,349 I459N probably damaging Het
Mkln1 A T 6: 31,474,486 Q454L probably benign Het
Mn1 A G 5: 111,419,937 E591G possibly damaging Het
Myo5c T A 9: 75,292,202 L1364Q probably damaging Het
Oas1d T C 5: 120,915,717 V80A probably damaging Het
Obscn A T 11: 59,038,848 D5180E probably damaging Het
Pax6 G A 2: 105,692,277 probably null Het
Pcdh15 A C 10: 74,324,389 N446T probably damaging Het
Pcnx2 A T 8: 125,855,230 F922L probably benign Het
Ptpn4 G T 1: 119,659,850 T921K probably benign Het
Selenov A G 7: 28,290,321 probably null Het
Tmem100 A G 11: 90,035,445 T33A probably benign Het
Tmem59 C T 4: 107,187,681 Q66* probably null Het
Trav21-dv12 T A 14: 53,876,613 Y63* probably null Het
Trim66 G T 7: 109,457,586 H1121Q probably damaging Het
Trim80 A G 11: 115,447,943 Y533C probably damaging Het
Ttc17 G A 2: 94,364,610 P520L probably damaging Het
Ttn A T 2: 76,791,749 V15483E probably damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfhx4 C A 3: 5,403,914 T3069K probably benign Het
Zfp281 A G 1: 136,625,710 H142R probably benign Het
Zfp462 G T 4: 55,060,044 R1190L probably damaging Het
Zfp935 T A 13: 62,454,417 H323L probably damaging Het
Other mutations in Gpam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Gpam APN 19 55078332 missense possibly damaging 0.71
IGL01349:Gpam APN 19 55096119 critical splice donor site probably null
IGL01515:Gpam APN 19 55087451 missense probably damaging 1.00
IGL01650:Gpam APN 19 55081700 missense probably benign 0.02
IGL01768:Gpam APN 19 55087520 missense probably benign 0.00
IGL01809:Gpam APN 19 55075625 nonsense probably null
IGL01878:Gpam APN 19 55083374 missense probably benign 0.22
IGL02451:Gpam APN 19 55088203 missense probably damaging 1.00
IGL03293:Gpam APN 19 55071016 missense probably benign
IGL03391:Gpam APN 19 55081696 missense probably damaging 1.00
R0492:Gpam UTSW 19 55096179 missense possibly damaging 0.72
R0703:Gpam UTSW 19 55072756 missense probably benign 0.00
R1083:Gpam UTSW 19 55088211 splice site probably benign
R1432:Gpam UTSW 19 55079261 missense probably damaging 0.99
R1457:Gpam UTSW 19 55088176 missense probably damaging 1.00
R1556:Gpam UTSW 19 55076331 missense possibly damaging 0.94
R1733:Gpam UTSW 19 55081469 missense probably damaging 0.99
R1744:Gpam UTSW 19 55074591 missense probably damaging 1.00
R1776:Gpam UTSW 19 55078575 missense possibly damaging 0.88
R2267:Gpam UTSW 19 55072710 critical splice donor site probably null
R2697:Gpam UTSW 19 55083209 missense probably damaging 1.00
R3836:Gpam UTSW 19 55080458 missense probably benign
R3837:Gpam UTSW 19 55080458 missense probably benign
R3838:Gpam UTSW 19 55080458 missense probably benign
R3839:Gpam UTSW 19 55080458 missense probably benign
R4670:Gpam UTSW 19 55096119 critical splice donor site probably null
R4717:Gpam UTSW 19 55075614 missense probably benign 0.00
R5104:Gpam UTSW 19 55093986 missense probably benign 0.44
R5146:Gpam UTSW 19 55093946 missense probably damaging 1.00
R5183:Gpam UTSW 19 55083227 missense probably damaging 1.00
R5326:Gpam UTSW 19 55091165 missense probably benign 0.05
R5347:Gpam UTSW 19 55088837 missense probably damaging 1.00
R5621:Gpam UTSW 19 55079260 missense probably damaging 1.00
R5644:Gpam UTSW 19 55088899 missense probably benign 0.00
R6244:Gpam UTSW 19 55070985 missense probably damaging 1.00
R6260:Gpam UTSW 19 55083406 missense probably benign 0.40
R6965:Gpam UTSW 19 55074609 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGAAAGCTAAGTCTCCTGTTC -3'
(R):5'- TCCTAGCTCGCGATTTCGAC -3'

Sequencing Primer
(F):5'- GAAAGCTAAGTCTCCTGTTCTCCCAG -3'
(R):5'- TAGCTCGCGATTTCGACCTAGG -3'
Posted On2016-02-04