Incidental Mutation 'R4820:Svep1'
ID370114
Institutional Source Beutler Lab
Gene Symbol Svep1
Ensembl Gene ENSMUSG00000028369
Gene Namesushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
SynonymsD430029O09Rik, 4833413O10Rik, Polydom, 1110021D17Rik
MMRRC Submission 042436-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.725) question?
Stock #R4820 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location58042442-58206859 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58082664 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1987 (T1987A)
Ref Sequence ENSEMBL: ENSMUSP00000045856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042850]
Predicted Effect probably benign
Transcript: ENSMUST00000042850
AA Change: T1987A

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000045856
Gene: ENSMUSG00000028369
AA Change: T1987A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 51 60 N/A INTRINSIC
VWA 82 261 2.18e-32 SMART
Pfam:GCC2_GCC3 311 361 3.4e-14 PFAM
CCP 379 434 3.62e-8 SMART
CCP 439 494 1.78e-16 SMART
CCP 499 559 2.13e-5 SMART
Pfam:HYR 560 642 1.7e-20 PFAM
Pfam:HYR 643 722 4.6e-15 PFAM
CCP 727 787 3.59e-1 SMART
low complexity region 862 873 N/A INTRINSIC
Pfam:GCC2_GCC3 1004 1051 3.2e-16 PFAM
Pfam:GCC2_GCC3 1058 1105 5.4e-19 PFAM
Pfam:GCC2_GCC3 1112 1159 7.7e-19 PFAM
EGF 1195 1228 3.12e-7 SMART
EGF_CA 1230 1266 3.93e-13 SMART
EGF_CA 1268 1304 8.3e-12 SMART
EGF_CA 1306 1342 4.59e-14 SMART
EGF_CA 1344 1380 8.69e-15 SMART
EGF_CA 1382 1418 3.42e-13 SMART
Pfam:Pentaxin 1429 1622 1.8e-28 PFAM
Pfam:Laminin_G_3 1432 1589 1.1e-20 PFAM
CCP 1630 1684 1.71e-9 SMART
CCP 1689 1742 2.31e-15 SMART
EGF_CA 1744 1783 5.23e-9 SMART
CCP 1788 1841 4.62e-15 SMART
CCP 1846 1899 8.29e-17 SMART
CCP 1904 1957 1.1e-12 SMART
CCP 1962 2015 5.6e-14 SMART
CCP 2020 2077 4.15e-8 SMART
CCP 2082 2140 8.11e-11 SMART
CCP 2145 2198 4.38e-16 SMART
CCP 2203 2258 1.69e-8 SMART
CCP 2263 2317 1.42e-15 SMART
CCP 2322 2375 3.1e-7 SMART
CCP 2380 2434 4.55e-14 SMART
CCP 2439 2492 6.95e-10 SMART
CCP 2497 2550 8.88e-17 SMART
CCP 2555 2607 1.7e-13 SMART
CCP 2651 2709 1.02e-7 SMART
CCP 2714 2767 9.6e-13 SMART
CCP 2772 2825 3.64e-13 SMART
CCP 2830 2883 6.63e-16 SMART
CCP 2888 2941 2.76e-13 SMART
CCP 2946 2999 4.41e-12 SMART
CCP 3004 3055 4.25e-5 SMART
CCP 3060 3113 5.15e-13 SMART
CCP 3118 3172 2.11e-9 SMART
CCP 3177 3232 1.02e-7 SMART
CCP 3237 3290 6.19e-16 SMART
CCP 3295 3348 5.35e-11 SMART
CCP 3353 3407 8.43e-9 SMART
CCP 3412 3464 2.44e-14 SMART
EGF 3467 3496 1.28e-3 SMART
EGF 3499 3528 1.15e-5 SMART
EGF 3531 3560 2.85e-1 SMART
Meta Mutation Damage Score 0.014 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 96% (104/108)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete preweaning lethality, edema, abnormal skin coloration, thick epidermis, acanthosis, and tail/limb abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930488N24Rik T C 17: 14,106,219 noncoding transcript Het
5730455P16Rik A T 11: 80,375,520 S132T possibly damaging Het
9930021J03Rik T C 19: 29,718,409 N1228S possibly damaging Het
Aadacl3 T A 4: 144,457,957 H77L probably damaging Het
Actr5 T A 2: 158,625,506 V122D probably damaging Het
Adamts7 A G 9: 90,189,686 D678G possibly damaging Het
Alpk1 T A 3: 127,671,059 D1190V probably benign Het
Apbb1ip A T 2: 22,875,253 N649Y unknown Het
Atp6v0a1 A G 11: 101,042,950 I522V probably benign Het
Cars T C 7: 143,570,564 D375G probably damaging Het
Catspere1 A T 1: 177,859,875 noncoding transcript Het
Ccdc87 A G 19: 4,840,551 D357G probably damaging Het
Cd101 A T 3: 101,022,155 S8T probably benign Het
Cfap65 C T 1: 74,927,632 A299T probably benign Het
Cic T C 7: 25,271,732 V296A possibly damaging Het
Col7a1 T A 9: 108,968,607 S1686T possibly damaging Het
Ctbp2 A C 7: 133,013,694 L504R probably damaging Het
Cttnbp2nl T C 3: 105,011,324 K67E probably benign Het
Cyp2c50 C T 19: 40,113,580 P480S probably damaging Het
Dcdc5 A C 2: 106,336,075 noncoding transcript Het
Defb2 G T 8: 21,843,301 E31* probably null Het
Dhrs1 T A 14: 55,739,626 N244I possibly damaging Het
Dopey2 A G 16: 93,793,090 I134V probably benign Het
Etl4 A G 2: 20,806,685 D1193G possibly damaging Het
Ezh1 A C 11: 101,203,768 S399R probably damaging Het
Fam161a T C 11: 23,020,076 S26P probably damaging Het
Fam205a1 T A 4: 42,851,815 I114F probably damaging Het
Fcgbp C A 7: 28,113,958 S2306Y probably damaging Het
Fras1 T C 5: 96,728,653 I2415T probably benign Het
Gas2l3 A G 10: 89,417,045 L246P probably damaging Het
Gdf15 C T 8: 70,629,596 V287M probably damaging Het
Gm10354 G T 5: 14,976,211 T144K probably benign Het
Gm2056 A T 12: 88,027,388 I129F unknown Het
Gm7742 T C 17: 21,199,973 noncoding transcript Het
Grin2d T C 7: 45,857,939 D446G probably damaging Het
Hemk1 A G 9: 107,328,186 F107L probably benign Het
Hmgcr C T 13: 96,660,192 G197S probably damaging Het
Ift52 G A 2: 163,031,188 G207D probably benign Het
Il17re A G 6: 113,465,855 T275A probably benign Het
Iqcf3 T C 9: 106,553,589 probably benign Het
Kcna1 A G 6: 126,642,136 I407T probably damaging Het
Kcnrg T A 14: 61,607,937 M142K probably benign Het
Lhx9 C A 1: 138,838,367 V237L probably benign Het
Lipo3 A C 19: 33,583,097 I56S probably damaging Het
Loxhd1 C G 18: 77,384,967 P1060R probably damaging Het
Map2k4 A C 11: 65,696,375 probably benign Het
Methig1 A G 15: 100,353,535 K109R possibly damaging Het
Mmrn1 G A 6: 60,973,043 V326I probably benign Het
Myo15 G A 11: 60,476,915 R167H probably damaging Het
Ncoa7 G A 10: 30,648,476 T142M probably damaging Het
Nfkb2 C A 19: 46,308,054 Q254K probably damaging Het
Nol6 G T 4: 41,121,508 P278Q probably damaging Het
Nptxr T A 15: 79,792,826 D285V probably damaging Het
Olfr1414 A T 1: 92,511,090 *313K probably null Het
Olfr429 A G 1: 174,089,176 I45M possibly damaging Het
Oosp3 T C 19: 11,711,633 W82R probably damaging Het
Pa2g4 G T 10: 128,559,330 T322K probably damaging Het
Parp16 C A 9: 65,237,893 F291L probably damaging Het
Pdzd9 A T 7: 120,668,396 D65E probably damaging Het
Pgap3 A G 11: 98,390,474 W238R probably damaging Het
Pgf G A 12: 85,171,764 H67Y probably benign Het
Pik3cb T C 9: 99,073,626 T413A probably benign Het
Plcxd2 A T 16: 45,980,337 C175S probably benign Het
Pou2f1 A T 1: 165,891,948 probably benign Het
Ppfia1 T G 7: 144,498,369 N846T probably benign Het
Ppid T A 3: 79,595,197 probably null Het
Prkcq G A 2: 11,226,986 probably null Het
Ptgds T C 2: 25,469,046 K66E probably benign Het
Ptpmt1 A G 2: 90,917,938 noncoding transcript Het
Rab3il1 G A 19: 10,026,670 G51D probably benign Het
Rdx T C 9: 52,063,591 V9A probably damaging Het
Rpl7l1 T C 17: 46,778,088 N239S probably benign Het
Rrbp1 C A 2: 143,964,765 A978S possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGCCGGCGGCG 7: 97,579,919 probably benign Het
Scn3a A T 2: 65,461,278 I1708N probably damaging Het
Serinc1 A G 10: 57,525,370 I109T possibly damaging Het
Shroom1 G A 11: 53,465,139 V339I probably benign Het
Slc30a8 T A 15: 52,306,484 C36S probably benign Het
Slc9a3r1 A G 11: 115,180,092 E290G probably benign Het
Slco1b2 A G 6: 141,685,432 I597M probably benign Het
Snx27 A G 3: 94,520,211 F228S probably damaging Het
Stim1 T A 7: 102,415,364 F214I probably damaging Het
Tamm41 A G 6: 115,025,417 I18T possibly damaging Het
Tmem150b T A 7: 4,723,872 D79V probably damaging Het
Tmem167 T A 13: 90,104,429 I68N probably benign Het
Traf3 A G 12: 111,260,770 E339G possibly damaging Het
Tspan12 G A 6: 21,795,661 P177S probably damaging Het
Ttn A G 2: 76,953,218 I810T probably benign Het
Ulk1 T C 5: 110,792,130 T407A probably benign Het
Uroc1 G A 6: 90,357,618 probably null Het
Vmn2r-ps69 T C 7: 85,310,376 noncoding transcript Het
Wdr59 T C 8: 111,480,814 N476S probably benign Het
Zfp472 A G 17: 32,977,442 M164V probably benign Het
Zfp608 T C 18: 54,987,684 N277S probably benign Het
Zfp831 T C 2: 174,705,304 C1427R possibly damaging Het
Other mutations in Svep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Svep1 APN 4 58176077 missense probably damaging 0.98
IGL00489:Svep1 APN 4 58068988 missense possibly damaging 0.71
IGL00496:Svep1 APN 4 58069001 missense possibly damaging 0.95
IGL00864:Svep1 APN 4 58068533 nonsense probably null
IGL00904:Svep1 APN 4 58097398 missense probably benign 0.00
IGL00935:Svep1 APN 4 58090664 missense possibly damaging 0.71
IGL00963:Svep1 APN 4 58072791 nonsense probably null
IGL01077:Svep1 APN 4 58068760 missense possibly damaging 0.71
IGL01084:Svep1 APN 4 58111419 missense possibly damaging 0.71
IGL01150:Svep1 APN 4 58070302 missense probably benign 0.04
IGL01161:Svep1 APN 4 58146569 missense probably damaging 0.96
IGL01360:Svep1 APN 4 58116554 missense possibly damaging 0.73
IGL01365:Svep1 APN 4 58100878 critical splice acceptor site probably null
IGL01396:Svep1 APN 4 58068552 missense possibly damaging 0.85
IGL01601:Svep1 APN 4 58084872 missense probably damaging 1.00
IGL01636:Svep1 APN 4 58116622 missense possibly damaging 0.96
IGL01838:Svep1 APN 4 58121910 missense possibly damaging 0.72
IGL01949:Svep1 APN 4 58176006 missense probably damaging 1.00
IGL01984:Svep1 APN 4 58068877 missense possibly damaging 0.93
IGL02005:Svep1 APN 4 58069056 missense possibly damaging 0.93
IGL02036:Svep1 APN 4 58088245 missense possibly damaging 0.85
IGL02039:Svep1 APN 4 58123980 critical splice donor site probably null
IGL02043:Svep1 APN 4 58068556 missense probably benign 0.19
IGL02073:Svep1 APN 4 58070104 missense probably benign 0.06
IGL02188:Svep1 APN 4 58068382 missense possibly damaging 0.71
IGL02256:Svep1 APN 4 58070311 missense possibly damaging 0.71
IGL02284:Svep1 APN 4 58072819 missense probably benign 0.32
IGL02323:Svep1 APN 4 58070236 nonsense probably null
IGL02440:Svep1 APN 4 58145293 missense probably benign 0.06
IGL02449:Svep1 APN 4 58070296 missense possibly damaging 0.71
IGL02501:Svep1 APN 4 58145341 splice site probably benign
IGL02568:Svep1 APN 4 58135441 missense probably benign 0.42
IGL02625:Svep1 APN 4 58115807 missense possibly damaging 0.53
IGL02795:Svep1 APN 4 58123223 missense probably damaging 1.00
IGL02818:Svep1 APN 4 58069804 missense possibly damaging 0.71
IGL02871:Svep1 APN 4 58100871 missense probably benign
IGL02875:Svep1 APN 4 58082821 splice site probably benign
IGL02887:Svep1 APN 4 58145301 missense probably damaging 1.00
IGL03240:Svep1 APN 4 58048188 missense possibly damaging 0.73
IGL03243:Svep1 APN 4 58133387 missense probably benign 0.06
IGL03264:Svep1 APN 4 58066422 splice site probably benign
IGL03288:Svep1 APN 4 58116532 missense probably benign 0.01
IGL03340:Svep1 APN 4 58111451 missense possibly damaging 0.96
IGL03341:Svep1 APN 4 58070308 nonsense probably null
IGL03348:Svep1 APN 4 58113635 missense probably damaging 1.00
R0001:Svep1 UTSW 4 58066460 missense possibly damaging 0.93
R0042:Svep1 UTSW 4 58123192 missense possibly damaging 0.92
R0042:Svep1 UTSW 4 58123192 missense possibly damaging 0.92
R0125:Svep1 UTSW 4 58099937 splice site probably benign
R0142:Svep1 UTSW 4 58118232 missense probably benign 0.33
R0147:Svep1 UTSW 4 58116608 missense possibly damaging 0.85
R0148:Svep1 UTSW 4 58116608 missense possibly damaging 0.85
R0157:Svep1 UTSW 4 58069830 missense possibly damaging 0.72
R0195:Svep1 UTSW 4 58089514 missense possibly damaging 0.82
R0197:Svep1 UTSW 4 58070851 missense possibly damaging 0.71
R0257:Svep1 UTSW 4 58179610 missense possibly damaging 0.71
R0314:Svep1 UTSW 4 58096331 missense possibly damaging 0.71
R0316:Svep1 UTSW 4 58072737 missense probably damaging 0.98
R0322:Svep1 UTSW 4 58057996 splice site probably benign
R0426:Svep1 UTSW 4 58073333 missense possibly damaging 0.87
R0446:Svep1 UTSW 4 58088280 missense probably damaging 1.00
R0457:Svep1 UTSW 4 58118136 missense probably damaging 1.00
R0471:Svep1 UTSW 4 58054700 missense possibly damaging 0.85
R0555:Svep1 UTSW 4 58128858 missense possibly damaging 0.71
R0634:Svep1 UTSW 4 58070661 missense possibly damaging 0.86
R0636:Svep1 UTSW 4 58073121 nonsense probably null
R0827:Svep1 UTSW 4 58053113 splice site probably benign
R1025:Svep1 UTSW 4 58087817 missense possibly damaging 0.86
R1027:Svep1 UTSW 4 58094084 missense possibly damaging 0.86
R1069:Svep1 UTSW 4 58070239 missense probably damaging 1.00
R1161:Svep1 UTSW 4 58069416 missense possibly damaging 0.71
R1245:Svep1 UTSW 4 58066427 critical splice donor site probably null
R1282:Svep1 UTSW 4 58100032 missense possibly damaging 0.93
R1310:Svep1 UTSW 4 58069416 missense possibly damaging 0.71
R1444:Svep1 UTSW 4 58115754 missense possibly damaging 0.53
R1460:Svep1 UTSW 4 58068740 missense possibly damaging 0.85
R1500:Svep1 UTSW 4 58070239 missense probably damaging 1.00
R1628:Svep1 UTSW 4 58107561 missense probably benign 0.00
R1712:Svep1 UTSW 4 58070629 missense probably benign 0.06
R1774:Svep1 UTSW 4 58146562 missense possibly damaging 0.92
R1783:Svep1 UTSW 4 58073333 missense probably benign
R1829:Svep1 UTSW 4 58096310 missense possibly damaging 0.93
R1978:Svep1 UTSW 4 58097292 missense possibly damaging 0.73
R1993:Svep1 UTSW 4 58064170 critical splice donor site probably null
R2017:Svep1 UTSW 4 58070568 missense probably benign 0.08
R2058:Svep1 UTSW 4 58084554 missense possibly damaging 0.92
R2109:Svep1 UTSW 4 58206030 missense possibly damaging 0.51
R2215:Svep1 UTSW 4 58138602 splice site probably benign
R2281:Svep1 UTSW 4 58082677 missense possibly damaging 0.85
R2504:Svep1 UTSW 4 58135628 splice site probably null
R2763:Svep1 UTSW 4 58084061 missense possibly damaging 0.86
R3122:Svep1 UTSW 4 58087845 missense possibly damaging 0.51
R3605:Svep1 UTSW 4 58066542 missense probably benign 0.32
R3763:Svep1 UTSW 4 58084833 missense possibly damaging 0.89
R3827:Svep1 UTSW 4 58096177 missense probably damaging 0.98
R3829:Svep1 UTSW 4 58096177 missense probably damaging 0.98
R3830:Svep1 UTSW 4 58096177 missense probably damaging 0.98
R3910:Svep1 UTSW 4 58145156 critical splice donor site probably null
R3943:Svep1 UTSW 4 58084807 splice site probably null
R3944:Svep1 UTSW 4 58084807 splice site probably null
R4153:Svep1 UTSW 4 58089426 missense possibly damaging 0.52
R4154:Svep1 UTSW 4 58069068 missense possibly damaging 0.71
R4191:Svep1 UTSW 4 58046601 missense possibly damaging 0.86
R4355:Svep1 UTSW 4 58138695 missense possibly damaging 0.71
R4388:Svep1 UTSW 4 58069249 missense possibly damaging 0.93
R4532:Svep1 UTSW 4 58068886 missense possibly damaging 0.52
R4584:Svep1 UTSW 4 58068526 nonsense probably null
R4592:Svep1 UTSW 4 58084028 missense possibly damaging 0.93
R4593:Svep1 UTSW 4 58091944 missense possibly damaging 0.71
R4625:Svep1 UTSW 4 58072698 missense probably damaging 0.98
R4639:Svep1 UTSW 4 58082724 missense probably benign
R4700:Svep1 UTSW 4 58097323 missense possibly damaging 0.71
R4720:Svep1 UTSW 4 58205869 missense possibly damaging 0.71
R4724:Svep1 UTSW 4 58070752 missense possibly damaging 0.71
R4753:Svep1 UTSW 4 58053212 missense probably benign 0.06
R4781:Svep1 UTSW 4 58070340 missense probably damaging 0.98
R4896:Svep1 UTSW 4 58087751 missense probably benign 0.08
R4905:Svep1 UTSW 4 58069308 missense probably benign 0.00
R4910:Svep1 UTSW 4 58096276 missense possibly damaging 0.71
R4972:Svep1 UTSW 4 58087778 missense possibly damaging 0.71
R5004:Svep1 UTSW 4 58087751 missense probably benign 0.08
R5088:Svep1 UTSW 4 58120648 missense possibly damaging 0.73
R5112:Svep1 UTSW 4 58068610 nonsense probably null
R5185:Svep1 UTSW 4 58084534 missense probably damaging 0.99
R5302:Svep1 UTSW 4 58096183 missense possibly damaging 0.71
R5307:Svep1 UTSW 4 58072677 missense possibly damaging 0.71
R5339:Svep1 UTSW 4 58121892 missense possibly damaging 0.96
R5379:Svep1 UTSW 4 58072991 missense possibly damaging 0.51
R5384:Svep1 UTSW 4 58104545 missense possibly damaging 0.71
R5414:Svep1 UTSW 4 58206322 missense possibly damaging 0.53
R5514:Svep1 UTSW 4 58044054 missense possibly damaging 0.53
R5538:Svep1 UTSW 4 58049282 critical splice acceptor site probably null
R5549:Svep1 UTSW 4 58057954 missense probably benign 0.32
R5618:Svep1 UTSW 4 58070537 missense probably benign
R5623:Svep1 UTSW 4 58091964 missense possibly damaging 0.92
R5686:Svep1 UTSW 4 58072826 missense possibly damaging 0.71
R5743:Svep1 UTSW 4 58096223 missense possibly damaging 0.71
R5773:Svep1 UTSW 4 58099985 missense possibly damaging 0.86
R5809:Svep1 UTSW 4 58116524 missense possibly damaging 0.73
R5896:Svep1 UTSW 4 58084906 missense possibly damaging 0.71
R5918:Svep1 UTSW 4 58069345 missense possibly damaging 0.71
R5969:Svep1 UTSW 4 58070977 nonsense probably null
R6010:Svep1 UTSW 4 58115832 missense possibly damaging 0.95
R6187:Svep1 UTSW 4 58072872 missense probably damaging 1.00
R6192:Svep1 UTSW 4 58104536 missense possibly damaging 0.92
R6209:Svep1 UTSW 4 58128869 missense probably benign 0.32
R6234:Svep1 UTSW 4 58113458 intron probably null
R6326:Svep1 UTSW 4 58073045 missense possibly damaging 0.51
R6400:Svep1 UTSW 4 58049169 missense probably damaging 1.00
R6418:Svep1 UTSW 4 58053126 missense probably benign 0.01
R6440:Svep1 UTSW 4 58116555 missense possibly damaging 0.53
R6489:Svep1 UTSW 4 58100066 missense probably damaging 1.00
R6515:Svep1 UTSW 4 58088280 missense probably damaging 1.00
R6738:Svep1 UTSW 4 58123180 missense possibly damaging 0.71
R6773:Svep1 UTSW 4 58049146 missense possibly damaging 0.71
R6796:Svep1 UTSW 4 58064275 missense probably benign 0.01
X0063:Svep1 UTSW 4 58070468 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACACACCTGCTTCGATGAC -3'
(R):5'- TCCATGGAGAAAGTGGCCAC -3'

Sequencing Primer
(F):5'- GACTTTCCCACATTCTTGGTTAAAG -3'
(R):5'- AAGTGGCCACCCAGTGAG -3'
Posted On2016-02-04