Incidental Mutation 'R4820:Ctbp2'
ID370138
Institutional Source Beutler Lab
Gene Symbol Ctbp2
Ensembl Gene ENSMUSG00000030970
Gene NameC-terminal binding protein 2
SynonymsD7Ertd45e, Gtrgeo6, Ribeye
MMRRC Submission 042436-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4820 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location132987563-133124354 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 133013694 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 504 (L504R)
Ref Sequence ENSEMBL: ENSMUSP00000130294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033269] [ENSMUST00000124096] [ENSMUST00000163601] [ENSMUST00000165457] [ENSMUST00000166439] [ENSMUST00000167218] [ENSMUST00000168958] [ENSMUST00000169570] [ENSMUST00000170459] [ENSMUST00000172341]
Predicted Effect probably benign
Transcript: ENSMUST00000033269
SMART Domains Protein: ENSMUSP00000033269
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 36 358 2.9e-31 PFAM
Pfam:2-Hacid_dh_C 139 323 1.7e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164739
SMART Domains Protein: ENSMUSP00000130157
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164896
SMART Domains Protein: ENSMUSP00000129195
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165534
SMART Domains Protein: ENSMUSP00000132311
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166400
SMART Domains Protein: ENSMUSP00000131868
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166439
SMART Domains Protein: ENSMUSP00000127448
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 11 333 2.4e-31 PFAM
Pfam:2-Hacid_dh_C 114 298 1.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167218
Predicted Effect probably benign
Transcript: ENSMUST00000168958
SMART Domains Protein: ENSMUSP00000132892
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 19 164 6.3e-27 PFAM
Pfam:2-Hacid_dh_C 122 188 8.5e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169570
AA Change: L504R

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130294
Gene: ENSMUSG00000030970
AA Change: L504R

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 579 901 2.8e-31 PFAM
Pfam:2-Hacid_dh_C 682 866 5.6e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170459
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171727
SMART Domains Protein: ENSMUSP00000127123
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172341
SMART Domains Protein: ENSMUSP00000127701
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 36 177 5.6e-27 PFAM
Meta Mutation Damage Score 0.196 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 96% (104/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene produces alternative transcripts encoding two distinct proteins. One protein is a transcriptional repressor, while the other isoform is a major component of specialized synapses known as synaptic ribbons. Both proteins contain a NAD+ binding domain similar to NAD+-dependent 2-hydroxyacid dehydrogenases. A portion of the 3' untranslated region was used to map this gene to chromosome 21q21.3; however, it was noted that similar loci elsewhere in the genome are likely. Blast analysis shows that this gene is present on chromosome 10. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Embryos homozygous for a gene-trapped allele die by E10 exhibiting a small size, axial truncations, a thin neural epithelium, a dilated pericardium, delayed fore- and midbrain development, and defects in heart morphogenesis, placental development and extraembryonic vascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930488N24Rik T C 17: 14,106,219 noncoding transcript Het
5730455P16Rik A T 11: 80,375,520 S132T possibly damaging Het
9930021J03Rik T C 19: 29,718,409 N1228S possibly damaging Het
Aadacl3 T A 4: 144,457,957 H77L probably damaging Het
Actr5 T A 2: 158,625,506 V122D probably damaging Het
Adamts7 A G 9: 90,189,686 D678G possibly damaging Het
Alpk1 T A 3: 127,671,059 D1190V probably benign Het
Apbb1ip A T 2: 22,875,253 N649Y unknown Het
Atp6v0a1 A G 11: 101,042,950 I522V probably benign Het
Cars T C 7: 143,570,564 D375G probably damaging Het
Catspere1 A T 1: 177,859,875 noncoding transcript Het
Ccdc87 A G 19: 4,840,551 D357G probably damaging Het
Cd101 A T 3: 101,022,155 S8T probably benign Het
Cfap65 C T 1: 74,927,632 A299T probably benign Het
Cic T C 7: 25,271,732 V296A possibly damaging Het
Col7a1 T A 9: 108,968,607 S1686T possibly damaging Het
Cttnbp2nl T C 3: 105,011,324 K67E probably benign Het
Cyp2c50 C T 19: 40,113,580 P480S probably damaging Het
Dcdc5 A C 2: 106,336,075 noncoding transcript Het
Defb2 G T 8: 21,843,301 E31* probably null Het
Dhrs1 T A 14: 55,739,626 N244I possibly damaging Het
Dopey2 A G 16: 93,793,090 I134V probably benign Het
Etl4 A G 2: 20,806,685 D1193G possibly damaging Het
Ezh1 A C 11: 101,203,768 S399R probably damaging Het
Fam161a T C 11: 23,020,076 S26P probably damaging Het
Fam205a1 T A 4: 42,851,815 I114F probably damaging Het
Fcgbp C A 7: 28,113,958 S2306Y probably damaging Het
Fras1 T C 5: 96,728,653 I2415T probably benign Het
Gas2l3 A G 10: 89,417,045 L246P probably damaging Het
Gdf15 C T 8: 70,629,596 V287M probably damaging Het
Gm10354 G T 5: 14,976,211 T144K probably benign Het
Gm2056 A T 12: 88,027,388 I129F unknown Het
Gm7742 T C 17: 21,199,973 noncoding transcript Het
Grin2d T C 7: 45,857,939 D446G probably damaging Het
Hemk1 A G 9: 107,328,186 F107L probably benign Het
Hmgcr C T 13: 96,660,192 G197S probably damaging Het
Ift52 G A 2: 163,031,188 G207D probably benign Het
Il17re A G 6: 113,465,855 T275A probably benign Het
Iqcf3 T C 9: 106,553,589 probably benign Het
Kcna1 A G 6: 126,642,136 I407T probably damaging Het
Kcnrg T A 14: 61,607,937 M142K probably benign Het
Lhx9 C A 1: 138,838,367 V237L probably benign Het
Lipo3 A C 19: 33,583,097 I56S probably damaging Het
Loxhd1 C G 18: 77,384,967 P1060R probably damaging Het
Map2k4 A C 11: 65,696,375 probably benign Het
Methig1 A G 15: 100,353,535 K109R possibly damaging Het
Mmrn1 G A 6: 60,973,043 V326I probably benign Het
Myo15 G A 11: 60,476,915 R167H probably damaging Het
Ncoa7 G A 10: 30,648,476 T142M probably damaging Het
Nfkb2 C A 19: 46,308,054 Q254K probably damaging Het
Nol6 G T 4: 41,121,508 P278Q probably damaging Het
Nptxr T A 15: 79,792,826 D285V probably damaging Het
Olfr1414 A T 1: 92,511,090 *313K probably null Het
Olfr429 A G 1: 174,089,176 I45M possibly damaging Het
Oosp3 T C 19: 11,711,633 W82R probably damaging Het
Pa2g4 G T 10: 128,559,330 T322K probably damaging Het
Parp16 C A 9: 65,237,893 F291L probably damaging Het
Pdzd9 A T 7: 120,668,396 D65E probably damaging Het
Pgap3 A G 11: 98,390,474 W238R probably damaging Het
Pgf G A 12: 85,171,764 H67Y probably benign Het
Pik3cb T C 9: 99,073,626 T413A probably benign Het
Plcxd2 A T 16: 45,980,337 C175S probably benign Het
Pou2f1 A T 1: 165,891,948 probably benign Het
Ppfia1 T G 7: 144,498,369 N846T probably benign Het
Ppid T A 3: 79,595,197 probably null Het
Prkcq G A 2: 11,226,986 probably null Het
Ptgds T C 2: 25,469,046 K66E probably benign Het
Ptpmt1 A G 2: 90,917,938 noncoding transcript Het
Rab3il1 G A 19: 10,026,670 G51D probably benign Het
Rdx T C 9: 52,063,591 V9A probably damaging Het
Rpl7l1 T C 17: 46,778,088 N239S probably benign Het
Rrbp1 C A 2: 143,964,765 A978S possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGCCGGCGGCG 7: 97,579,919 probably benign Het
Scn3a A T 2: 65,461,278 I1708N probably damaging Het
Serinc1 A G 10: 57,525,370 I109T possibly damaging Het
Shroom1 G A 11: 53,465,139 V339I probably benign Het
Slc30a8 T A 15: 52,306,484 C36S probably benign Het
Slc9a3r1 A G 11: 115,180,092 E290G probably benign Het
Slco1b2 A G 6: 141,685,432 I597M probably benign Het
Snx27 A G 3: 94,520,211 F228S probably damaging Het
Stim1 T A 7: 102,415,364 F214I probably damaging Het
Svep1 T C 4: 58,082,664 T1987A probably benign Het
Tamm41 A G 6: 115,025,417 I18T possibly damaging Het
Tmem150b T A 7: 4,723,872 D79V probably damaging Het
Tmem167 T A 13: 90,104,429 I68N probably benign Het
Traf3 A G 12: 111,260,770 E339G possibly damaging Het
Tspan12 G A 6: 21,795,661 P177S probably damaging Het
Ttn A G 2: 76,953,218 I810T probably benign Het
Ulk1 T C 5: 110,792,130 T407A probably benign Het
Uroc1 G A 6: 90,357,618 probably null Het
Vmn2r-ps69 T C 7: 85,310,376 noncoding transcript Het
Wdr59 T C 8: 111,480,814 N476S probably benign Het
Zfp472 A G 17: 32,977,442 M164V probably benign Het
Zfp608 T C 18: 54,987,684 N277S probably benign Het
Zfp831 T C 2: 174,705,304 C1427R possibly damaging Het
Other mutations in Ctbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02143:Ctbp2 APN 7 132991156 missense probably damaging 0.98
IGL02615:Ctbp2 APN 7 132995347 missense probably benign 0.34
IGL02626:Ctbp2 APN 7 132999211 missense probably benign 0.12
R0068:Ctbp2 UTSW 7 132990059 missense possibly damaging 0.95
R0374:Ctbp2 UTSW 7 132999344 missense possibly damaging 0.89
R0566:Ctbp2 UTSW 7 132991147 missense probably damaging 1.00
R0571:Ctbp2 UTSW 7 133014805 missense probably damaging 1.00
R1247:Ctbp2 UTSW 7 132995189 missense probably benign 0.24
R1292:Ctbp2 UTSW 7 133015189 missense probably damaging 1.00
R1477:Ctbp2 UTSW 7 132998941 missense probably damaging 1.00
R1732:Ctbp2 UTSW 7 132998924 missense possibly damaging 0.80
R1807:Ctbp2 UTSW 7 133014408 missense probably benign 0.00
R1865:Ctbp2 UTSW 7 132990554 missense probably benign 0.02
R1951:Ctbp2 UTSW 7 133015027 missense probably benign
R2393:Ctbp2 UTSW 7 133023561 critical splice donor site probably null
R2410:Ctbp2 UTSW 7 133014354 missense probably benign 0.08
R3427:Ctbp2 UTSW 7 132991592 missense probably damaging 1.00
R4004:Ctbp2 UTSW 7 132991773 missense probably benign 0.31
R4243:Ctbp2 UTSW 7 132998854 missense probably benign 0.43
R4754:Ctbp2 UTSW 7 133023558 splice site probably null
R4947:Ctbp2 UTSW 7 132999283 missense probably damaging 1.00
R4960:Ctbp2 UTSW 7 133014238 missense probably benign 0.00
R4999:Ctbp2 UTSW 7 133014649 missense possibly damaging 0.62
R5340:Ctbp2 UTSW 7 133013963 missense probably benign 0.43
R5593:Ctbp2 UTSW 7 132998869 missense possibly damaging 0.95
R5762:Ctbp2 UTSW 7 132995359 missense probably damaging 1.00
R6913:Ctbp2 UTSW 7 133014726 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGGAGTTAGCATGGTTGACAC -3'
(R):5'- AGCTACTTATTCCACCCCAGTG -3'

Sequencing Primer
(F):5'- TTGACACGATGATGGGAGCCC -3'
(R):5'- AACTCTGGATATAGCTCTCCTACC -3'
Posted On2016-02-04