Incidental Mutation 'R4820:Col7a1'
ID370151
Institutional Source Beutler Lab
Gene Symbol Col7a1
Ensembl Gene ENSMUSG00000025650
Gene Namecollagen, type VII, alpha 1
Synonyms
MMRRC Submission 042436-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4820 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108953586-108984875 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108968607 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1686 (S1686T)
Ref Sequence ENSEMBL: ENSMUSP00000107701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026740] [ENSMUST00000112070]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026740
AA Change: S1686T

PolyPhen 2 Score 0.722 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000026740
Gene: ENSMUSG00000025650
AA Change: S1686T

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
VWA 37 217 1.56e-51 SMART
FN3 233 319 1.41e-10 SMART
FN3 325 405 6.54e-6 SMART
FN3 416 494 6.91e-5 SMART
FN3 509 585 1.24e-6 SMART
FN3 599 675 2.01e-6 SMART
FN3 687 763 7.45e-10 SMART
FN3 774 854 6.01e-5 SMART
FN3 865 944 7.23e-8 SMART
FN3 955 1038 2.16e-6 SMART
Pfam:VWA 1055 1227 2.3e-22 PFAM
Pfam:Collagen 1244 1311 2.4e-8 PFAM
Pfam:Collagen 1294 1355 4.1e-10 PFAM
low complexity region 1397 1414 N/A INTRINSIC
Pfam:Collagen 1447 1504 1.3e-9 PFAM
Pfam:Collagen 1487 1547 5e-8 PFAM
low complexity region 1572 1595 N/A INTRINSIC
low complexity region 1604 1632 N/A INTRINSIC
Pfam:Collagen 1646 1714 2.8e-10 PFAM
Pfam:Collagen 1713 1775 1.9e-10 PFAM
low complexity region 1776 1794 N/A INTRINSIC
low complexity region 1803 1833 N/A INTRINSIC
Pfam:Collagen 1875 1935 1.5e-8 PFAM
Pfam:Collagen 1969 2033 2.4e-9 PFAM
Pfam:Collagen 2025 2092 9.1e-10 PFAM
Pfam:Collagen 2089 2158 1.3e-10 PFAM
Pfam:Collagen 2147 2209 1.6e-9 PFAM
Pfam:Collagen 2245 2312 1.4e-8 PFAM
Pfam:Collagen 2313 2365 2.5e-8 PFAM
Pfam:Collagen 2364 2423 7.3e-10 PFAM
Pfam:Collagen 2398 2457 1.5e-9 PFAM
Pfam:Collagen 2456 2515 8.4e-11 PFAM
Pfam:Collagen 2516 2572 1.9e-9 PFAM
Pfam:Collagen 2560 2630 7.2e-9 PFAM
Pfam:Collagen 2605 2682 6e-9 PFAM
Pfam:Collagen 2659 2722 2e-8 PFAM
low complexity region 2745 2775 N/A INTRINSIC
Pfam:Kunitz_BPTI 2878 2932 3.2e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102188
Predicted Effect possibly damaging
Transcript: ENSMUST00000112070
AA Change: S1686T

PolyPhen 2 Score 0.722 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107701
Gene: ENSMUSG00000025650
AA Change: S1686T

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
VWA 37 217 1.56e-51 SMART
FN3 233 319 1.41e-10 SMART
FN3 325 405 6.54e-6 SMART
FN3 416 494 6.91e-5 SMART
FN3 509 585 1.24e-6 SMART
FN3 599 675 2.01e-6 SMART
FN3 687 763 7.45e-10 SMART
FN3 774 854 6.01e-5 SMART
FN3 865 944 7.23e-8 SMART
FN3 955 1038 2.16e-6 SMART
Pfam:VWA 1055 1230 2.2e-19 PFAM
Pfam:Collagen 1244 1311 2.5e-8 PFAM
Pfam:Collagen 1294 1355 4.2e-10 PFAM
low complexity region 1397 1414 N/A INTRINSIC
Pfam:Collagen 1447 1504 1.3e-9 PFAM
Pfam:Collagen 1487 1547 5.1e-8 PFAM
low complexity region 1572 1595 N/A INTRINSIC
low complexity region 1604 1632 N/A INTRINSIC
Pfam:Collagen 1646 1714 2.9e-10 PFAM
Pfam:Collagen 1713 1775 1.9e-10 PFAM
low complexity region 1776 1794 N/A INTRINSIC
low complexity region 1803 1833 N/A INTRINSIC
Pfam:Collagen 1875 1935 1.5e-8 PFAM
Pfam:Collagen 1969 2033 2.5e-9 PFAM
Pfam:Collagen 2025 2092 9.4e-10 PFAM
Pfam:Collagen 2089 2158 1.3e-10 PFAM
Pfam:Collagen 2147 2209 1.6e-9 PFAM
Pfam:Collagen 2195 2266 7.7e-7 PFAM
Pfam:Collagen 2245 2312 1.4e-8 PFAM
Pfam:Collagen 2313 2365 2.6e-8 PFAM
Pfam:Collagen 2364 2423 7.6e-10 PFAM
Pfam:Collagen 2398 2457 1.5e-9 PFAM
Pfam:Collagen 2456 2515 8.7e-11 PFAM
Pfam:Collagen 2516 2572 2e-9 PFAM
Pfam:Collagen 2560 2630 7.4e-9 PFAM
Pfam:Collagen 2605 2682 6.2e-9 PFAM
Pfam:Collagen 2659 2722 2.1e-8 PFAM
Pfam:Collagen 2719 2778 1.6e-7 PFAM
Pfam:Kunitz_BPTI 2878 2932 1.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126780
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127905
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 96% (104/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type VII collagen. The type VII collagen fibril, composed of three identical alpha collagen chains, is restricted to the basement zone beneath stratified squamous epithelia. It functions as an anchoring fibril between the external epithelia and the underlying stroma. Mutations in this gene are associated with all forms of dystrophic epidermolysis bullosa. In the absence of mutations, however, an acquired form of this disease can result from an autoimmune response made to type VII collagen. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are unable to reproduce and display postnatal growth retardation, blisters and erosion at sites of trauma, nonpigmented hair growth associated with hair loss, subepidermal blistering associated with poorly formed hemidesmosomes, and high postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930488N24Rik T C 17: 14,106,219 noncoding transcript Het
5730455P16Rik A T 11: 80,375,520 S132T possibly damaging Het
9930021J03Rik T C 19: 29,718,409 N1228S possibly damaging Het
Aadacl3 T A 4: 144,457,957 H77L probably damaging Het
Actr5 T A 2: 158,625,506 V122D probably damaging Het
Adamts7 A G 9: 90,189,686 D678G possibly damaging Het
Alpk1 T A 3: 127,671,059 D1190V probably benign Het
Apbb1ip A T 2: 22,875,253 N649Y unknown Het
Atp6v0a1 A G 11: 101,042,950 I522V probably benign Het
Cars T C 7: 143,570,564 D375G probably damaging Het
Catspere1 A T 1: 177,859,875 noncoding transcript Het
Ccdc87 A G 19: 4,840,551 D357G probably damaging Het
Cd101 A T 3: 101,022,155 S8T probably benign Het
Cfap65 C T 1: 74,927,632 A299T probably benign Het
Cic T C 7: 25,271,732 V296A possibly damaging Het
Ctbp2 A C 7: 133,013,694 L504R probably damaging Het
Cttnbp2nl T C 3: 105,011,324 K67E probably benign Het
Cyp2c50 C T 19: 40,113,580 P480S probably damaging Het
Dcdc5 A C 2: 106,336,075 noncoding transcript Het
Defb2 G T 8: 21,843,301 E31* probably null Het
Dhrs1 T A 14: 55,739,626 N244I possibly damaging Het
Dopey2 A G 16: 93,793,090 I134V probably benign Het
Etl4 A G 2: 20,806,685 D1193G possibly damaging Het
Ezh1 A C 11: 101,203,768 S399R probably damaging Het
Fam161a T C 11: 23,020,076 S26P probably damaging Het
Fam205a1 T A 4: 42,851,815 I114F probably damaging Het
Fcgbp C A 7: 28,113,958 S2306Y probably damaging Het
Fras1 T C 5: 96,728,653 I2415T probably benign Het
Gas2l3 A G 10: 89,417,045 L246P probably damaging Het
Gdf15 C T 8: 70,629,596 V287M probably damaging Het
Gm10354 G T 5: 14,976,211 T144K probably benign Het
Gm2056 A T 12: 88,027,388 I129F unknown Het
Gm7742 T C 17: 21,199,973 noncoding transcript Het
Grin2d T C 7: 45,857,939 D446G probably damaging Het
Hemk1 A G 9: 107,328,186 F107L probably benign Het
Hmgcr C T 13: 96,660,192 G197S probably damaging Het
Ift52 G A 2: 163,031,188 G207D probably benign Het
Il17re A G 6: 113,465,855 T275A probably benign Het
Iqcf3 T C 9: 106,553,589 probably benign Het
Kcna1 A G 6: 126,642,136 I407T probably damaging Het
Kcnrg T A 14: 61,607,937 M142K probably benign Het
Lhx9 C A 1: 138,838,367 V237L probably benign Het
Lipo3 A C 19: 33,583,097 I56S probably damaging Het
Loxhd1 C G 18: 77,384,967 P1060R probably damaging Het
Map2k4 A C 11: 65,696,375 probably benign Het
Methig1 A G 15: 100,353,535 K109R possibly damaging Het
Mmrn1 G A 6: 60,973,043 V326I probably benign Het
Myo15 G A 11: 60,476,915 R167H probably damaging Het
Ncoa7 G A 10: 30,648,476 T142M probably damaging Het
Nfkb2 C A 19: 46,308,054 Q254K probably damaging Het
Nol6 G T 4: 41,121,508 P278Q probably damaging Het
Nptxr T A 15: 79,792,826 D285V probably damaging Het
Olfr1414 A T 1: 92,511,090 *313K probably null Het
Olfr429 A G 1: 174,089,176 I45M possibly damaging Het
Oosp3 T C 19: 11,711,633 W82R probably damaging Het
Pa2g4 G T 10: 128,559,330 T322K probably damaging Het
Parp16 C A 9: 65,237,893 F291L probably damaging Het
Pdzd9 A T 7: 120,668,396 D65E probably damaging Het
Pgap3 A G 11: 98,390,474 W238R probably damaging Het
Pgf G A 12: 85,171,764 H67Y probably benign Het
Pik3cb T C 9: 99,073,626 T413A probably benign Het
Plcxd2 A T 16: 45,980,337 C175S probably benign Het
Pou2f1 A T 1: 165,891,948 probably benign Het
Ppfia1 T G 7: 144,498,369 N846T probably benign Het
Ppid T A 3: 79,595,197 probably null Het
Prkcq G A 2: 11,226,986 probably null Het
Ptgds T C 2: 25,469,046 K66E probably benign Het
Ptpmt1 A G 2: 90,917,938 noncoding transcript Het
Rab3il1 G A 19: 10,026,670 G51D probably benign Het
Rdx T C 9: 52,063,591 V9A probably damaging Het
Rpl7l1 T C 17: 46,778,088 N239S probably benign Het
Rrbp1 C A 2: 143,964,765 A978S possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGCCGGCGGCG 7: 97,579,919 probably benign Het
Scn3a A T 2: 65,461,278 I1708N probably damaging Het
Serinc1 A G 10: 57,525,370 I109T possibly damaging Het
Shroom1 G A 11: 53,465,139 V339I probably benign Het
Slc30a8 T A 15: 52,306,484 C36S probably benign Het
Slc9a3r1 A G 11: 115,180,092 E290G probably benign Het
Slco1b2 A G 6: 141,685,432 I597M probably benign Het
Snx27 A G 3: 94,520,211 F228S probably damaging Het
Stim1 T A 7: 102,415,364 F214I probably damaging Het
Svep1 T C 4: 58,082,664 T1987A probably benign Het
Tamm41 A G 6: 115,025,417 I18T possibly damaging Het
Tmem150b T A 7: 4,723,872 D79V probably damaging Het
Tmem167 T A 13: 90,104,429 I68N probably benign Het
Traf3 A G 12: 111,260,770 E339G possibly damaging Het
Tspan12 G A 6: 21,795,661 P177S probably damaging Het
Ttn A G 2: 76,953,218 I810T probably benign Het
Ulk1 T C 5: 110,792,130 T407A probably benign Het
Uroc1 G A 6: 90,357,618 probably null Het
Vmn2r-ps69 T C 7: 85,310,376 noncoding transcript Het
Wdr59 T C 8: 111,480,814 N476S probably benign Het
Zfp472 A G 17: 32,977,442 M164V probably benign Het
Zfp608 T C 18: 54,987,684 N277S probably benign Het
Zfp831 T C 2: 174,705,304 C1427R possibly damaging Het
Other mutations in Col7a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Col7a1 APN 9 108977697 nonsense probably null
IGL01366:Col7a1 APN 9 108977119 splice site probably benign
IGL01395:Col7a1 APN 9 108983912 unclassified probably benign
IGL01410:Col7a1 APN 9 108964618 missense unknown
IGL01902:Col7a1 APN 9 108977827 missense unknown
IGL01915:Col7a1 APN 9 108955745 missense unknown
IGL01936:Col7a1 APN 9 108967999 splice site probably benign
IGL01943:Col7a1 APN 9 108984016 critical splice acceptor site probably null
IGL02026:Col7a1 APN 9 108968029 missense probably damaging 1.00
IGL02168:Col7a1 APN 9 108984075 unclassified probably benign
IGL02504:Col7a1 APN 9 108980675 missense unknown
IGL02510:Col7a1 APN 9 108973231 splice site probably benign
IGL02559:Col7a1 APN 9 108973216 missense unknown
IGL02583:Col7a1 APN 9 108962229 missense unknown
IGL02728:Col7a1 APN 9 108984104 missense probably benign 0.39
IGL03003:Col7a1 APN 9 108974956 critical splice donor site probably null
IGL03096:Col7a1 APN 9 108955788 missense unknown
IGL03122:Col7a1 APN 9 108961683 missense unknown
IGL03212:Col7a1 APN 9 108974452 missense unknown
IGL03240:Col7a1 APN 9 108968373 missense probably null 1.00
IGL03355:Col7a1 APN 9 108978160 missense unknown
smallified UTSW 9 108972813 critical splice donor site probably null
underwood UTSW 9 108968875 critical splice acceptor site probably null
PIT4131001:Col7a1 UTSW 9 108965921 splice site probably benign
R0007:Col7a1 UTSW 9 108961403 missense unknown
R0007:Col7a1 UTSW 9 108961403 missense unknown
R0078:Col7a1 UTSW 9 108974913 splice site probably benign
R0091:Col7a1 UTSW 9 108967506 splice site probably benign
R0126:Col7a1 UTSW 9 108969583 splice site probably benign
R0244:Col7a1 UTSW 9 108972184 splice site probably null
R0331:Col7a1 UTSW 9 108967502 splice site probably benign
R0375:Col7a1 UTSW 9 108980237 missense unknown
R0601:Col7a1 UTSW 9 108980584 splice site probably benign
R0609:Col7a1 UTSW 9 108958147 missense unknown
R0709:Col7a1 UTSW 9 108961548 splice site probably benign
R0879:Col7a1 UTSW 9 108976091 splice site probably benign
R1175:Col7a1 UTSW 9 108955334 missense unknown
R1177:Col7a1 UTSW 9 108962441 missense unknown
R1435:Col7a1 UTSW 9 108963273 missense unknown
R1497:Col7a1 UTSW 9 108978825 missense unknown
R1549:Col7a1 UTSW 9 108955966 missense unknown
R1794:Col7a1 UTSW 9 108965928 missense unknown
R1801:Col7a1 UTSW 9 108960997 missense unknown
R1848:Col7a1 UTSW 9 108969565 missense possibly damaging 0.83
R1899:Col7a1 UTSW 9 108978888 missense unknown
R1944:Col7a1 UTSW 9 108960010 missense unknown
R1945:Col7a1 UTSW 9 108960010 missense unknown
R1955:Col7a1 UTSW 9 108955664 missense unknown
R2009:Col7a1 UTSW 9 108968875 critical splice acceptor site probably null
R2034:Col7a1 UTSW 9 108963007 missense unknown
R3148:Col7a1 UTSW 9 108961405 missense unknown
R3713:Col7a1 UTSW 9 108964440 nonsense probably null
R4078:Col7a1 UTSW 9 108960991 missense unknown
R4193:Col7a1 UTSW 9 108956672 missense unknown
R4232:Col7a1 UTSW 9 108972813 critical splice donor site probably null
R4528:Col7a1 UTSW 9 108959533 missense unknown
R4771:Col7a1 UTSW 9 108971925 missense probably damaging 0.99
R4896:Col7a1 UTSW 9 108957277 missense unknown
R4911:Col7a1 UTSW 9 108975219 missense unknown
R4915:Col7a1 UTSW 9 108966464 missense unknown
R4917:Col7a1 UTSW 9 108966464 missense unknown
R5001:Col7a1 UTSW 9 108965078 critical splice donor site probably null
R5352:Col7a1 UTSW 9 108961411 missense unknown
R5361:Col7a1 UTSW 9 108963224 missense unknown
R5730:Col7a1 UTSW 9 108972242 critical splice donor site probably null
R5838:Col7a1 UTSW 9 108978143 missense unknown
R5842:Col7a1 UTSW 9 108965815 missense unknown
R5932:Col7a1 UTSW 9 108980211 missense unknown
R6091:Col7a1 UTSW 9 108955334 missense unknown
R6144:Col7a1 UTSW 9 108974080 missense unknown
R6158:Col7a1 UTSW 9 108964603 missense unknown
R6170:Col7a1 UTSW 9 108966443 missense unknown
R6247:Col7a1 UTSW 9 108981062 unclassified probably benign
R6338:Col7a1 UTSW 9 108956633 missense unknown
R6339:Col7a1 UTSW 9 108956633 missense unknown
R6382:Col7a1 UTSW 9 108975393 missense unknown
R6518:Col7a1 UTSW 9 108955527 missense unknown
R6533:Col7a1 UTSW 9 108961358 missense unknown
R6569:Col7a1 UTSW 9 108978110 splice site probably null
R6596:Col7a1 UTSW 9 108954341 unclassified probably benign
R6697:Col7a1 UTSW 9 108970533 missense probably damaging 1.00
R6753:Col7a1 UTSW 9 108958128 missense unknown
R6849:Col7a1 UTSW 9 108975053 missense unknown
R6915:Col7a1 UTSW 9 108967618 missense probably benign 0.02
R6974:Col7a1 UTSW 9 108969426 missense possibly damaging 0.82
X0023:Col7a1 UTSW 9 108984185 unclassified probably benign
Z1088:Col7a1 UTSW 9 108978500 splice site silent
Predicted Primers PCR Primer
(F):5'- TGTGAGTCTCAACCTGTGGC -3'
(R):5'- GCCAATTCCCAGAATGCAGC -3'

Sequencing Primer
(F):5'- AACCTGTGGCCCCTCAC -3'
(R):5'- TTCCCAGAATGCAGCTAAGG -3'
Posted On2016-02-04