Incidental Mutation 'R4820:Pa2g4'
ID370155
Institutional Source Beutler Lab
Gene Symbol Pa2g4
Ensembl Gene ENSMUSG00000025364
Gene Nameproliferation-associated 2G4
SynonymsPlfap, Ebp1
MMRRC Submission 042436-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.538) question?
Stock #R4820 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location128557766-128565987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 128559330 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 322 (T322K)
Ref Sequence ENSEMBL: ENSMUSP00000114434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026425] [ENSMUST00000131728]
Predicted Effect probably damaging
Transcript: ENSMUST00000026425
AA Change: T322K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026425
Gene: ENSMUSG00000025364
AA Change: T322K

DomainStartEndE-ValueType
Pfam:Peptidase_M24 19 293 2.1e-27 PFAM
low complexity region 359 377 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131728
AA Change: T322K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114434
Gene: ENSMUSG00000025364
AA Change: T322K

DomainStartEndE-ValueType
Pfam:Peptidase_M24 19 232 1.2e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197964
Meta Mutation Damage Score 0.474 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 96% (104/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is involved in growth regulation. This protein is present in pre-ribosomal ribonucleoprotein complexes and may be involved in ribosome assembly and the regulation of intermediate and late steps of rRNA processing. This protein can interact with the cytoplasmic domain of the ErbB3 receptor and may contribute to transducing growth regulatory signals. This protein is also a transcriptional co-repressor of androgen receptor-regulated genes and other cell cycle regulatory genes through its interactions with histone deacetylases. This protein has been implicated in growth inhibition and the induction of differentiation of human cancer cells. Six pseudogenes, located on chromosomes 3, 6, 9, 18, 20 and X, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased body size and weight during early adulthood and produce smaller than normal litters. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930488N24Rik T C 17: 14,106,219 noncoding transcript Het
5730455P16Rik A T 11: 80,375,520 S132T possibly damaging Het
9930021J03Rik T C 19: 29,718,409 N1228S possibly damaging Het
Aadacl3 T A 4: 144,457,957 H77L probably damaging Het
Actr5 T A 2: 158,625,506 V122D probably damaging Het
Adamts7 A G 9: 90,189,686 D678G possibly damaging Het
Alpk1 T A 3: 127,671,059 D1190V probably benign Het
Apbb1ip A T 2: 22,875,253 N649Y unknown Het
Atp6v0a1 A G 11: 101,042,950 I522V probably benign Het
Cars T C 7: 143,570,564 D375G probably damaging Het
Catspere1 A T 1: 177,859,875 noncoding transcript Het
Ccdc87 A G 19: 4,840,551 D357G probably damaging Het
Cd101 A T 3: 101,022,155 S8T probably benign Het
Cfap65 C T 1: 74,927,632 A299T probably benign Het
Cic T C 7: 25,271,732 V296A possibly damaging Het
Col7a1 T A 9: 108,968,607 S1686T possibly damaging Het
Ctbp2 A C 7: 133,013,694 L504R probably damaging Het
Cttnbp2nl T C 3: 105,011,324 K67E probably benign Het
Cyp2c50 C T 19: 40,113,580 P480S probably damaging Het
Dcdc5 A C 2: 106,336,075 noncoding transcript Het
Defb2 G T 8: 21,843,301 E31* probably null Het
Dhrs1 T A 14: 55,739,626 N244I possibly damaging Het
Dopey2 A G 16: 93,793,090 I134V probably benign Het
Etl4 A G 2: 20,806,685 D1193G possibly damaging Het
Ezh1 A C 11: 101,203,768 S399R probably damaging Het
Fam161a T C 11: 23,020,076 S26P probably damaging Het
Fam205a1 T A 4: 42,851,815 I114F probably damaging Het
Fcgbp C A 7: 28,113,958 S2306Y probably damaging Het
Fras1 T C 5: 96,728,653 I2415T probably benign Het
Gas2l3 A G 10: 89,417,045 L246P probably damaging Het
Gdf15 C T 8: 70,629,596 V287M probably damaging Het
Gm10354 G T 5: 14,976,211 T144K probably benign Het
Gm2056 A T 12: 88,027,388 I129F unknown Het
Gm7742 T C 17: 21,199,973 noncoding transcript Het
Grin2d T C 7: 45,857,939 D446G probably damaging Het
Hemk1 A G 9: 107,328,186 F107L probably benign Het
Hmgcr C T 13: 96,660,192 G197S probably damaging Het
Ift52 G A 2: 163,031,188 G207D probably benign Het
Il17re A G 6: 113,465,855 T275A probably benign Het
Iqcf3 T C 9: 106,553,589 probably benign Het
Kcna1 A G 6: 126,642,136 I407T probably damaging Het
Kcnrg T A 14: 61,607,937 M142K probably benign Het
Lhx9 C A 1: 138,838,367 V237L probably benign Het
Lipo3 A C 19: 33,583,097 I56S probably damaging Het
Loxhd1 C G 18: 77,384,967 P1060R probably damaging Het
Map2k4 A C 11: 65,696,375 probably benign Het
Methig1 A G 15: 100,353,535 K109R possibly damaging Het
Mmrn1 G A 6: 60,973,043 V326I probably benign Het
Myo15 G A 11: 60,476,915 R167H probably damaging Het
Ncoa7 G A 10: 30,648,476 T142M probably damaging Het
Nfkb2 C A 19: 46,308,054 Q254K probably damaging Het
Nol6 G T 4: 41,121,508 P278Q probably damaging Het
Nptxr T A 15: 79,792,826 D285V probably damaging Het
Olfr1414 A T 1: 92,511,090 *313K probably null Het
Olfr429 A G 1: 174,089,176 I45M possibly damaging Het
Oosp3 T C 19: 11,711,633 W82R probably damaging Het
Parp16 C A 9: 65,237,893 F291L probably damaging Het
Pdzd9 A T 7: 120,668,396 D65E probably damaging Het
Pgap3 A G 11: 98,390,474 W238R probably damaging Het
Pgf G A 12: 85,171,764 H67Y probably benign Het
Pik3cb T C 9: 99,073,626 T413A probably benign Het
Plcxd2 A T 16: 45,980,337 C175S probably benign Het
Pou2f1 A T 1: 165,891,948 probably benign Het
Ppfia1 T G 7: 144,498,369 N846T probably benign Het
Ppid T A 3: 79,595,197 probably null Het
Prkcq G A 2: 11,226,986 probably null Het
Ptgds T C 2: 25,469,046 K66E probably benign Het
Ptpmt1 A G 2: 90,917,938 noncoding transcript Het
Rab3il1 G A 19: 10,026,670 G51D probably benign Het
Rdx T C 9: 52,063,591 V9A probably damaging Het
Rpl7l1 T C 17: 46,778,088 N239S probably benign Het
Rrbp1 C A 2: 143,964,765 A978S possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGCCGGCGGCG 7: 97,579,919 probably benign Het
Scn3a A T 2: 65,461,278 I1708N probably damaging Het
Serinc1 A G 10: 57,525,370 I109T possibly damaging Het
Shroom1 G A 11: 53,465,139 V339I probably benign Het
Slc30a8 T A 15: 52,306,484 C36S probably benign Het
Slc9a3r1 A G 11: 115,180,092 E290G probably benign Het
Slco1b2 A G 6: 141,685,432 I597M probably benign Het
Snx27 A G 3: 94,520,211 F228S probably damaging Het
Stim1 T A 7: 102,415,364 F214I probably damaging Het
Svep1 T C 4: 58,082,664 T1987A probably benign Het
Tamm41 A G 6: 115,025,417 I18T possibly damaging Het
Tmem150b T A 7: 4,723,872 D79V probably damaging Het
Tmem167 T A 13: 90,104,429 I68N probably benign Het
Traf3 A G 12: 111,260,770 E339G possibly damaging Het
Tspan12 G A 6: 21,795,661 P177S probably damaging Het
Ttn A G 2: 76,953,218 I810T probably benign Het
Ulk1 T C 5: 110,792,130 T407A probably benign Het
Uroc1 G A 6: 90,357,618 probably null Het
Vmn2r-ps69 T C 7: 85,310,376 noncoding transcript Het
Wdr59 T C 8: 111,480,814 N476S probably benign Het
Zfp472 A G 17: 32,977,442 M164V probably benign Het
Zfp608 T C 18: 54,987,684 N277S probably benign Het
Zfp831 T C 2: 174,705,304 C1427R possibly damaging Het
Other mutations in Pa2g4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03165:Pa2g4 APN 10 128559060 critical splice donor site probably null
IGL03198:Pa2g4 APN 10 128565778 missense probably damaging 1.00
IGL03297:Pa2g4 APN 10 128563236 missense probably damaging 1.00
R0238:Pa2g4 UTSW 10 128563642 missense probably benign
R0238:Pa2g4 UTSW 10 128563642 missense probably benign
R1326:Pa2g4 UTSW 10 128559273 missense probably benign 0.06
R3620:Pa2g4 UTSW 10 128563595 missense probably damaging 1.00
R5680:Pa2g4 UTSW 10 128559457 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GTCCTGAGCAATGTGGGATC -3'
(R):5'- TCTCCCCAGAGCATTTGAAG -3'

Sequencing Primer
(F):5'- TCCTGAGCAATGTGGGATCATAAAG -3'
(R):5'- TCTCCCCAGAGCATTTGAAGATGAG -3'
Posted On2016-02-04