Incidental Mutation 'R4820:Nptxr'
ID370172
Institutional Source Beutler Lab
Gene Symbol Nptxr
Ensembl Gene ENSMUSG00000022421
Gene Nameneuronal pentraxin receptor
SynonymsNPR, D15Bwg0580e, 5730406O18Rik, 1700036C17Rik, NPCD
MMRRC Submission 042436-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4820 (G1)
Quality Score153
Status Validated
Chromosome15
Chromosomal Location79786351-79804766 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79792826 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 285 (D285V)
Ref Sequence ENSEMBL: ENSMUSP00000023057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023057] [ENSMUST00000023060] [ENSMUST00000089299] [ENSMUST00000175858]
Predicted Effect probably damaging
Transcript: ENSMUST00000023057
AA Change: D285V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023057
Gene: ENSMUSG00000022421
AA Change: D285V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 43 53 N/A INTRINSIC
low complexity region 57 71 N/A INTRINSIC
low complexity region 77 93 N/A INTRINSIC
PTX 281 487 2.17e-97 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000023060
AA Change: D164V

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023060
Gene: ENSMUSG00000089837
AA Change: D164V

DomainStartEndE-ValueType
CHROMO 10 62 1.46e-18 SMART
PTX 160 366 2.17e-97 SMART
Predicted Effect unknown
Transcript: ENSMUST00000089299
AA Change: D261V
SMART Domains Protein: ENSMUSP00000086714
Gene: ENSMUSG00000089837
AA Change: D261V

DomainStartEndE-ValueType
CHROMO 10 62 1.46e-18 SMART
low complexity region 98 115 N/A INTRINSIC
PTX 257 463 2.17e-97 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125283
Predicted Effect probably damaging
Transcript: ENSMUST00000175858
AA Change: D285V

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135855
Gene: ENSMUSG00000022421
AA Change: D285V

DomainStartEndE-ValueType
CHROMO 10 62 1.46e-18 SMART
PTX 160 366 2.17e-97 SMART
Meta Mutation Damage Score 0.34 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 96% (104/108)
MGI Phenotype FUNCTION: This gene encodes a protein similar to the rat neuronal pentraxin receptor. The rat pentraxin receptor is an integral membrane protein that is thought to mediate neuronal uptake of the snake venom toxin, taipoxin, and its transport into the synapses. Studies in rat indicate that translation of this mRNA initiates at a non-AUG (CUG) codon. This may also be true for mouse and human, based on strong sequence conservation amongst these species. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation of this gene display a mild alteration in retinal ganglion cell innervation but are fertile with no obvious behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930488N24Rik T C 17: 14,106,219 noncoding transcript Het
5730455P16Rik A T 11: 80,375,520 S132T possibly damaging Het
9930021J03Rik T C 19: 29,718,409 N1228S possibly damaging Het
Aadacl3 T A 4: 144,457,957 H77L probably damaging Het
Actr5 T A 2: 158,625,506 V122D probably damaging Het
Adamts7 A G 9: 90,189,686 D678G possibly damaging Het
Alpk1 T A 3: 127,671,059 D1190V probably benign Het
Apbb1ip A T 2: 22,875,253 N649Y unknown Het
Atp6v0a1 A G 11: 101,042,950 I522V probably benign Het
Cars T C 7: 143,570,564 D375G probably damaging Het
Catspere1 A T 1: 177,859,875 noncoding transcript Het
Ccdc87 A G 19: 4,840,551 D357G probably damaging Het
Cd101 A T 3: 101,022,155 S8T probably benign Het
Cfap65 C T 1: 74,927,632 A299T probably benign Het
Cic T C 7: 25,271,732 V296A possibly damaging Het
Col7a1 T A 9: 108,968,607 S1686T possibly damaging Het
Ctbp2 A C 7: 133,013,694 L504R probably damaging Het
Cttnbp2nl T C 3: 105,011,324 K67E probably benign Het
Cyp2c50 C T 19: 40,113,580 P480S probably damaging Het
Dcdc5 A C 2: 106,336,075 noncoding transcript Het
Defb2 G T 8: 21,843,301 E31* probably null Het
Dhrs1 T A 14: 55,739,626 N244I possibly damaging Het
Dopey2 A G 16: 93,793,090 I134V probably benign Het
Etl4 A G 2: 20,806,685 D1193G possibly damaging Het
Ezh1 A C 11: 101,203,768 S399R probably damaging Het
Fam161a T C 11: 23,020,076 S26P probably damaging Het
Fam205a1 T A 4: 42,851,815 I114F probably damaging Het
Fcgbp C A 7: 28,113,958 S2306Y probably damaging Het
Fras1 T C 5: 96,728,653 I2415T probably benign Het
Gas2l3 A G 10: 89,417,045 L246P probably damaging Het
Gdf15 C T 8: 70,629,596 V287M probably damaging Het
Gm10354 G T 5: 14,976,211 T144K probably benign Het
Gm2056 A T 12: 88,027,388 I129F unknown Het
Gm7742 T C 17: 21,199,973 noncoding transcript Het
Grin2d T C 7: 45,857,939 D446G probably damaging Het
Hemk1 A G 9: 107,328,186 F107L probably benign Het
Hmgcr C T 13: 96,660,192 G197S probably damaging Het
Ift52 G A 2: 163,031,188 G207D probably benign Het
Il17re A G 6: 113,465,855 T275A probably benign Het
Iqcf3 T C 9: 106,553,589 probably benign Het
Kcna1 A G 6: 126,642,136 I407T probably damaging Het
Kcnrg T A 14: 61,607,937 M142K probably benign Het
Lhx9 C A 1: 138,838,367 V237L probably benign Het
Lipo3 A C 19: 33,583,097 I56S probably damaging Het
Loxhd1 C G 18: 77,384,967 P1060R probably damaging Het
Map2k4 A C 11: 65,696,375 probably benign Het
Methig1 A G 15: 100,353,535 K109R possibly damaging Het
Mmrn1 G A 6: 60,973,043 V326I probably benign Het
Myo15 G A 11: 60,476,915 R167H probably damaging Het
Ncoa7 G A 10: 30,648,476 T142M probably damaging Het
Nfkb2 C A 19: 46,308,054 Q254K probably damaging Het
Nol6 G T 4: 41,121,508 P278Q probably damaging Het
Olfr1414 A T 1: 92,511,090 *313K probably null Het
Olfr429 A G 1: 174,089,176 I45M possibly damaging Het
Oosp3 T C 19: 11,711,633 W82R probably damaging Het
Pa2g4 G T 10: 128,559,330 T322K probably damaging Het
Parp16 C A 9: 65,237,893 F291L probably damaging Het
Pdzd9 A T 7: 120,668,396 D65E probably damaging Het
Pgap3 A G 11: 98,390,474 W238R probably damaging Het
Pgf G A 12: 85,171,764 H67Y probably benign Het
Pik3cb T C 9: 99,073,626 T413A probably benign Het
Plcxd2 A T 16: 45,980,337 C175S probably benign Het
Pou2f1 A T 1: 165,891,948 probably benign Het
Ppfia1 T G 7: 144,498,369 N846T probably benign Het
Ppid T A 3: 79,595,197 probably null Het
Prkcq G A 2: 11,226,986 probably null Het
Ptgds T C 2: 25,469,046 K66E probably benign Het
Ptpmt1 A G 2: 90,917,938 noncoding transcript Het
Rab3il1 G A 19: 10,026,670 G51D probably benign Het
Rdx T C 9: 52,063,591 V9A probably damaging Het
Rpl7l1 T C 17: 46,778,088 N239S probably benign Het
Rrbp1 C A 2: 143,964,765 A978S possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGCCGGCGGCG 7: 97,579,919 probably benign Het
Scn3a A T 2: 65,461,278 I1708N probably damaging Het
Serinc1 A G 10: 57,525,370 I109T possibly damaging Het
Shroom1 G A 11: 53,465,139 V339I probably benign Het
Slc30a8 T A 15: 52,306,484 C36S probably benign Het
Slc9a3r1 A G 11: 115,180,092 E290G probably benign Het
Slco1b2 A G 6: 141,685,432 I597M probably benign Het
Snx27 A G 3: 94,520,211 F228S probably damaging Het
Stim1 T A 7: 102,415,364 F214I probably damaging Het
Svep1 T C 4: 58,082,664 T1987A probably benign Het
Tamm41 A G 6: 115,025,417 I18T possibly damaging Het
Tmem150b T A 7: 4,723,872 D79V probably damaging Het
Tmem167 T A 13: 90,104,429 I68N probably benign Het
Traf3 A G 12: 111,260,770 E339G possibly damaging Het
Tspan12 G A 6: 21,795,661 P177S probably damaging Het
Ttn A G 2: 76,953,218 I810T probably benign Het
Ulk1 T C 5: 110,792,130 T407A probably benign Het
Uroc1 G A 6: 90,357,618 probably null Het
Vmn2r-ps69 T C 7: 85,310,376 noncoding transcript Het
Wdr59 T C 8: 111,480,814 N476S probably benign Het
Zfp472 A G 17: 32,977,442 M164V probably benign Het
Zfp608 T C 18: 54,987,684 N277S probably benign Het
Zfp831 T C 2: 174,705,304 C1427R possibly damaging Het
Other mutations in Nptxr
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0180:Nptxr UTSW 15 79794403 missense probably benign 0.09
R0208:Nptxr UTSW 15 79789715 missense probably null 1.00
R1055:Nptxr UTSW 15 79790255 splice site probably benign
R1487:Nptxr UTSW 15 79789903 missense probably damaging 1.00
R5948:Nptxr UTSW 15 79789841 missense probably benign 0.42
R6357:Nptxr UTSW 15 79794315 missense possibly damaging 0.78
X0017:Nptxr UTSW 15 79789842 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCAGCTCCTAGGTAGAGCTAG -3'
(R):5'- GGGCCCAATTTAGTCTCACC -3'

Sequencing Primer
(F):5'- TGATCAGCAGCTCCATTGG -3'
(R):5'- TAGTCTCACCTCTCAGCCCAGAG -3'
Posted On2016-02-04