Incidental Mutation 'R4821:Frk'
ID370229
Institutional Source Beutler Lab
Gene Symbol Frk
Ensembl Gene ENSMUSG00000019779
Gene Namefyn-related kinase
SynonymsGTK, BSK/IYK
MMRRC Submission 042437-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.392) question?
Stock #R4821 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location34483399-34611278 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34484237 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 78 (V78A)
Ref Sequence ENSEMBL: ENSMUSP00000130289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019913] [ENSMUST00000170771]
Predicted Effect probably benign
Transcript: ENSMUST00000019913
AA Change: V78A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000019913
Gene: ENSMUSG00000019779
AA Change: V78A

DomainStartEndE-ValueType
SH3 52 116 2.76e-19 SMART
SH2 121 206 4.97e-37 SMART
TyrKc 241 494 8.58e-137 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170771
AA Change: V78A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000130289
Gene: ENSMUSG00000019779
AA Change: V78A

DomainStartEndE-ValueType
SH3 52 116 2.76e-19 SMART
SH2 121 206 4.97e-37 SMART
TyrKc 241 494 8.58e-137 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215594
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TYR family of protein kinases. This tyrosine kinase is a nuclear protein and may function during G1 and S phase of the cell cycle and suppress growth. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation do not exhibit increased susceptibility to spontaneous tumors nor increased sensitivity to inoizing radiation. Epithelial tissues appear similar to controls, but circulating levels of T3 were significantly reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,235,674 K150R probably damaging Het
4930430A15Rik T C 2: 111,204,145 probably null Het
Aak1 T C 6: 86,850,189 V46A probably damaging Het
Abcb9 T C 5: 124,090,149 T10A probably benign Het
Acaca A G 11: 84,294,987 D116G possibly damaging Het
Adam33 G A 2: 131,061,195 P43L probably benign Het
Adamtsl2 T A 2: 27,098,592 probably null Het
Akap13 A G 7: 75,677,507 probably benign Het
Art1 T A 7: 102,107,178 L192Q probably damaging Het
Baalc A G 15: 38,933,180 probably benign Het
Baz2a A G 10: 128,111,109 E164G probably damaging Het
Bcs1l A G 1: 74,591,985 I391V probably benign Het
Cacna1c T C 6: 118,696,425 T497A probably damaging Het
Cap2 C A 13: 46,610,110 T164N probably damaging Het
Ccdc173 T C 2: 69,782,108 E96G possibly damaging Het
Ccdc57 A G 11: 120,860,399 probably null Het
Ccdc88c T C 12: 100,938,079 N1120S probably benign Het
Chd7 T A 4: 8,844,706 V1605D probably damaging Het
Col12a1 A T 9: 79,715,340 probably benign Het
Commd3 T C 2: 18,672,528 S22P probably benign Het
Cpd T C 11: 76,846,237 I244V probably benign Het
Cpeb2 C A 5: 43,233,474 probably benign Het
Cyp2c65 A G 19: 39,072,191 D165G probably damaging Het
Ddx1 T C 12: 13,239,147 Y152C probably damaging Het
Dennd4a G A 9: 64,897,249 C1290Y possibly damaging Het
Ebf4 G A 2: 130,307,045 M232I probably benign Het
Farp2 A G 1: 93,574,470 probably null Het
Gm5799 A G 14: 43,544,641 D90G probably damaging Het
Gpr45 C G 1: 43,030,453 probably benign Het
Hfm1 C T 5: 106,854,740 probably null Het
Igkv4-57-1 T A 6: 69,544,403 D105V probably damaging Het
Impdh2-ps A G 8: 100,031,363 noncoding transcript Het
Kctd4 G A 14: 75,962,777 V63I probably benign Het
Lcn6 T A 2: 25,680,810 L137M probably damaging Het
Lonrf1 T C 8: 36,219,972 N737D probably benign Het
Mcu C T 10: 59,467,689 V109M probably damaging Het
Mecom C A 3: 29,985,351 K186N probably damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Mybpc1 T C 10: 88,548,865 D533G probably damaging Het
Nae1 A C 8: 104,519,784 C294G probably damaging Het
Ncapg2 T G 12: 116,415,457 H190Q probably damaging Het
Nkx2-2 A T 2: 147,185,843 L59Q possibly damaging Het
Nrxn3 C T 12: 90,204,709 T295I probably damaging Het
Obscn C T 11: 59,006,826 probably benign Het
Obscn A T 11: 59,040,467 M5781K probably damaging Het
Olfr1285 T C 2: 111,409,225 noncoding transcript Het
Olfr1427 T A 19: 12,098,746 M298L probably benign Het
Olfr739 A G 14: 50,424,749 T77A possibly damaging Het
Pcdhb6 C A 18: 37,334,328 P101T probably damaging Het
Pot1b A G 17: 55,672,885 S324P possibly damaging Het
Ppcdc C T 9: 57,434,911 V43I probably benign Het
Prr13 A T 15: 102,460,685 probably benign Het
Rab10os T A 12: 3,237,322 noncoding transcript Het
Rabgap1 T C 2: 37,532,519 S595P probably damaging Het
Rap1gap T C 4: 137,712,129 S126P probably damaging Het
Rgs6 A T 12: 83,067,411 probably null Het
Slc5a6 T A 5: 31,036,884 K610* probably null Het
Sun5 C T 2: 153,869,466 V27I probably benign Het
Tmco5b T C 2: 113,289,757 I126T probably benign Het
Tmed7 G A 18: 46,593,413 Q92* probably null Het
Trav7d-2 A G 14: 52,684,428 D98G probably benign Het
Trbv16 T A 6: 41,152,002 L40Q probably damaging Het
Ush2a T C 1: 188,753,651 V2986A probably benign Het
Usp33 T C 3: 152,358,673 V58A probably benign Het
Vmn2r94 T A 17: 18,257,031 M373L probably benign Het
Ywhaq T C 12: 21,417,511 probably benign Het
Zbbx G A 3: 75,081,747 H345Y possibly damaging Het
Zfp346 G T 13: 55,113,813 probably benign Het
Zfp616 C T 11: 74,084,207 A434V probably benign Het
Zfp992 C T 4: 146,467,519 H566Y probably damaging Het
Other mutations in Frk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Frk APN 10 34484243 missense probably damaging 0.98
IGL01402:Frk APN 10 34547385 missense probably damaging 1.00
IGL02197:Frk APN 10 34484334 missense probably damaging 1.00
IGL02289:Frk APN 10 34484366 missense probably damaging 0.99
IGL02618:Frk APN 10 34583964 missense possibly damaging 0.88
IGL02885:Frk APN 10 34484071 missense probably benign 0.03
IGL03256:Frk APN 10 34607842 missense probably benign 0.00
R0299:Frk UTSW 10 34484371 critical splice donor site probably null
R0697:Frk UTSW 10 34607837 missense probably benign 0.12
R1033:Frk UTSW 10 34608458 missense probably damaging 1.00
R1583:Frk UTSW 10 34591810 critical splice acceptor site probably null
R1793:Frk UTSW 10 34607882 missense probably benign 0.05
R2248:Frk UTSW 10 34608531 missense probably benign 0.10
R3084:Frk UTSW 10 34607954 missense probably damaging 1.00
R3086:Frk UTSW 10 34607954 missense probably damaging 1.00
R3765:Frk UTSW 10 34484005 start codon destroyed probably null 0.98
R3766:Frk UTSW 10 34484005 start codon destroyed probably null 0.98
R3906:Frk UTSW 10 34584056 missense probably benign 0.00
R4163:Frk UTSW 10 34591872 missense probably damaging 0.98
R4486:Frk UTSW 10 34608381 missense probably benign 0.10
R4591:Frk UTSW 10 34605833 missense probably benign 0.03
R5070:Frk UTSW 10 34484284 nonsense probably null
R6172:Frk UTSW 10 34591965 missense probably damaging 1.00
R6572:Frk UTSW 10 34583967 missense probably benign 0.00
R6619:Frk UTSW 10 34605839 missense probably benign 0.22
R7307:Frk UTSW 10 34591938 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGACTCTGGGCATACCTG -3'
(R):5'- AGAGTTCAGTATCCAACCCCG -3'

Sequencing Primer
(F):5'- TGCTGGTCTCAAGAGGCAGAC -3'
(R):5'- GTTCAGTATCCAACCCCGAAAGAATC -3'
Posted On2016-02-04