Incidental Mutation 'R4821:Olfr739'
ID370249
Institutional Source Beutler Lab
Gene Symbol Olfr739
Ensembl Gene ENSMUSG00000057903
Gene Nameolfactory receptor 739
SynonymsMOR106-2, GA_x6K02T2PMLR-6121675-6122604
MMRRC Submission 042437-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R4821 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location50418626-50427888 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50424749 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 77 (T77A)
Ref Sequence ENSEMBL: ENSMUSP00000150559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075261] [ENSMUST00000216949]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075261
AA Change: T77A

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074740
Gene: ENSMUSG00000057903
AA Change: T77A

DomainStartEndE-ValueType
Pfam:7tm_4 33 309 1.1e-53 PFAM
Pfam:7tm_1 43 292 1.9e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216949
AA Change: T77A

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.218 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,235,674 K150R probably damaging Het
4930430A15Rik T C 2: 111,204,145 probably null Het
Aak1 T C 6: 86,850,189 V46A probably damaging Het
Abcb9 T C 5: 124,090,149 T10A probably benign Het
Acaca A G 11: 84,294,987 D116G possibly damaging Het
Adam33 G A 2: 131,061,195 P43L probably benign Het
Adamtsl2 T A 2: 27,098,592 probably null Het
Akap13 A G 7: 75,677,507 probably benign Het
Art1 T A 7: 102,107,178 L192Q probably damaging Het
Baalc A G 15: 38,933,180 probably benign Het
Baz2a A G 10: 128,111,109 E164G probably damaging Het
Bcs1l A G 1: 74,591,985 I391V probably benign Het
Cacna1c T C 6: 118,696,425 T497A probably damaging Het
Cap2 C A 13: 46,610,110 T164N probably damaging Het
Ccdc173 T C 2: 69,782,108 E96G possibly damaging Het
Ccdc57 A G 11: 120,860,399 probably null Het
Ccdc88c T C 12: 100,938,079 N1120S probably benign Het
Chd7 T A 4: 8,844,706 V1605D probably damaging Het
Col12a1 A T 9: 79,715,340 probably benign Het
Commd3 T C 2: 18,672,528 S22P probably benign Het
Cpd T C 11: 76,846,237 I244V probably benign Het
Cpeb2 C A 5: 43,233,474 probably benign Het
Cyp2c65 A G 19: 39,072,191 D165G probably damaging Het
Ddx1 T C 12: 13,239,147 Y152C probably damaging Het
Dennd4a G A 9: 64,897,249 C1290Y possibly damaging Het
Ebf4 G A 2: 130,307,045 M232I probably benign Het
Farp2 A G 1: 93,574,470 probably null Het
Frk T C 10: 34,484,237 V78A probably benign Het
Gm5799 A G 14: 43,544,641 D90G probably damaging Het
Gpr45 C G 1: 43,030,453 probably benign Het
Hfm1 C T 5: 106,854,740 probably null Het
Igkv4-57-1 T A 6: 69,544,403 D105V probably damaging Het
Impdh2-ps A G 8: 100,031,363 noncoding transcript Het
Kctd4 G A 14: 75,962,777 V63I probably benign Het
Lcn6 T A 2: 25,680,810 L137M probably damaging Het
Lonrf1 T C 8: 36,219,972 N737D probably benign Het
Mcu C T 10: 59,467,689 V109M probably damaging Het
Mecom C A 3: 29,985,351 K186N probably damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Mybpc1 T C 10: 88,548,865 D533G probably damaging Het
Nae1 A C 8: 104,519,784 C294G probably damaging Het
Ncapg2 T G 12: 116,415,457 H190Q probably damaging Het
Nkx2-2 A T 2: 147,185,843 L59Q possibly damaging Het
Nrxn3 C T 12: 90,204,709 T295I probably damaging Het
Obscn C T 11: 59,006,826 probably benign Het
Obscn A T 11: 59,040,467 M5781K probably damaging Het
Olfr1285 T C 2: 111,409,225 noncoding transcript Het
Olfr1427 T A 19: 12,098,746 M298L probably benign Het
Pcdhb6 C A 18: 37,334,328 P101T probably damaging Het
Pot1b A G 17: 55,672,885 S324P possibly damaging Het
Ppcdc C T 9: 57,434,911 V43I probably benign Het
Prr13 A T 15: 102,460,685 probably benign Het
Rab10os T A 12: 3,237,322 noncoding transcript Het
Rabgap1 T C 2: 37,532,519 S595P probably damaging Het
Rap1gap T C 4: 137,712,129 S126P probably damaging Het
Rgs6 A T 12: 83,067,411 probably null Het
Slc5a6 T A 5: 31,036,884 K610* probably null Het
Sun5 C T 2: 153,869,466 V27I probably benign Het
Tmco5b T C 2: 113,289,757 I126T probably benign Het
Tmed7 G A 18: 46,593,413 Q92* probably null Het
Trav7d-2 A G 14: 52,684,428 D98G probably benign Het
Trbv16 T A 6: 41,152,002 L40Q probably damaging Het
Ush2a T C 1: 188,753,651 V2986A probably benign Het
Usp33 T C 3: 152,358,673 V58A probably benign Het
Vmn2r94 T A 17: 18,257,031 M373L probably benign Het
Ywhaq T C 12: 21,417,511 probably benign Het
Zbbx G A 3: 75,081,747 H345Y possibly damaging Het
Zfp346 G T 13: 55,113,813 probably benign Het
Zfp616 C T 11: 74,084,207 A434V probably benign Het
Zfp992 C T 4: 146,467,519 H566Y probably damaging Het
Other mutations in Olfr739
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01719:Olfr739 APN 14 50424561 missense possibly damaging 0.88
IGL02430:Olfr739 APN 14 50425151 missense probably benign
IGL02603:Olfr739 APN 14 50425200 missense probably damaging 1.00
IGL02959:Olfr739 APN 14 50424932 missense possibly damaging 0.76
IGL03154:Olfr739 APN 14 50424623 missense probably benign 0.00
R0455:Olfr739 UTSW 14 50424902 missense possibly damaging 0.45
R1984:Olfr739 UTSW 14 50425391 missense possibly damaging 0.93
R3160:Olfr739 UTSW 14 50425031 missense probably damaging 0.99
R3161:Olfr739 UTSW 14 50425031 missense probably damaging 0.99
R3162:Olfr739 UTSW 14 50425031 missense probably damaging 0.99
R4880:Olfr739 UTSW 14 50425301 missense possibly damaging 0.90
R5047:Olfr739 UTSW 14 50425239 missense probably damaging 1.00
R5384:Olfr739 UTSW 14 50425389 missense possibly damaging 0.77
R5385:Olfr739 UTSW 14 50425389 missense possibly damaging 0.77
R5386:Olfr739 UTSW 14 50425389 missense possibly damaging 0.77
R5640:Olfr739 UTSW 14 50424654 missense probably benign 0.18
R5809:Olfr739 UTSW 14 50425448 makesense probably null
R6035:Olfr739 UTSW 14 50424527 missense probably benign
R6035:Olfr739 UTSW 14 50424527 missense probably benign
R6229:Olfr739 UTSW 14 50425205 missense probably benign 0.38
R6614:Olfr739 UTSW 14 50425089 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTGGCTTCATCCTCTTGGG -3'
(R):5'- TCACAAGGATGTTGCAGAGG -3'

Sequencing Primer
(F):5'- GCTTCATCCTCTTGGGCTTCC -3'
(R):5'- TGCCCAGTCATGAGAGCAG -3'
Posted On2016-02-04