Incidental Mutation 'R4801:Neb'
ID370362
Institutional Source Beutler Lab
Gene Symbol Neb
Ensembl Gene ENSMUSG00000026950
Gene Namenebulin
Synonyms
MMRRC Submission 042423-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.491) question?
Stock #R4801 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location52136647-52378474 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52200703 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1352 (T1352A)
Ref Sequence ENSEMBL: ENSMUSP00000074773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028320] [ENSMUST00000036934] [ENSMUST00000075301]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028320
AA Change: T1352A

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000028320
Gene: ENSMUSG00000026950
AA Change: T1352A

DomainStartEndE-ValueType
low complexity region 8 26 N/A INTRINSIC
low complexity region 27 36 N/A INTRINSIC
NEBU 103 134 9.67e-1 SMART
NEBU 137 167 6.6e-7 SMART
NEBU 172 202 9.7e-5 SMART
NEBU 208 238 3.48e-6 SMART
NEBU 246 276 2.66e-2 SMART
NEBU 281 311 5.32e-2 SMART
NEBU 312 342 2.94e-4 SMART
NEBU 346 377 1.34e1 SMART
NEBU 380 410 2.06e-8 SMART
NEBU 415 445 1.67e-8 SMART
NEBU 450 480 8.57e-6 SMART
NEBU 487 518 8.47e0 SMART
NEBU 523 553 5.2e-5 SMART
NEBU 554 584 1.07e-6 SMART
NEBU 589 619 9.55e-4 SMART
NEBU 622 652 6.21e-3 SMART
NEBU 657 686 4.89e-1 SMART
NEBU 692 722 4.7e-3 SMART
NEBU 730 760 1.16e-2 SMART
NEBU 765 795 5.32e-2 SMART
NEBU 796 826 3.62e-4 SMART
NEBU 831 861 1.88e-2 SMART
NEBU 866 896 1.59e-9 SMART
NEBU 901 931 2.7e-3 SMART
NEBU 937 967 4.93e0 SMART
NEBU 975 1005 2.89e1 SMART
NEBU 1010 1040 1.94e-4 SMART
NEBU 1041 1071 3.2e-5 SMART
NEBU 1076 1106 3.71e-1 SMART
NEBU 1111 1141 1.52e-6 SMART
NEBU 1146 1176 4.56e-1 SMART
NEBU 1182 1212 2.39e-4 SMART
NEBU 1220 1250 1.59e1 SMART
NEBU 1255 1285 4.32e-2 SMART
NEBU 1286 1316 4.39e0 SMART
NEBU 1321 1351 5.04e-3 SMART
NEBU 1356 1386 8.78e-3 SMART
NEBU 1392 1422 6.02e-1 SMART
NEBU 1427 1457 5.24e-1 SMART
NEBU 1463 1493 1.53e-2 SMART
NEBU 1498 1528 1.94e-4 SMART
NEBU 1533 1563 1.16e-2 SMART
NEBU 1568 1598 2.51e1 SMART
NEBU 1603 1633 2.81e-1 SMART
NEBU 1638 1668 7.64e-3 SMART
NEBU 1673 1703 5.62e-1 SMART
NEBU 1708 1738 1.49e-5 SMART
NEBU 1743 1773 3.97e-1 SMART
NEBU 1778 1808 1.47e-4 SMART
NEBU 1813 1843 6.45e-1 SMART
NEBU 1848 1878 1.28e-4 SMART
NEBU 1883 1913 9.33e-7 SMART
NEBU 1918 1948 7.58e-7 SMART
NEBU 1954 1984 1.94e-4 SMART
NEBU 1989 2019 9.93e-2 SMART
NEBU 2024 2054 2.45e-1 SMART
NEBU 2059 2089 8.39e-1 SMART
NEBU 2094 2124 1e-6 SMART
NEBU 2131 2161 7.35e-5 SMART
NEBU 2168 2198 1.37e-4 SMART
NEBU 2202 2232 2.83e-6 SMART
NEBU 2237 2267 1.52e-6 SMART
NEBU 2274 2304 5.21e0 SMART
NEBU 2309 2339 7.53e-2 SMART
NEBU 2344 2374 2.5e-7 SMART
NEBU 2377 2409 1.16e-2 SMART
NEBU 2416 2446 1.47e-4 SMART
NEBU 2453 2483 3.2e-5 SMART
NEBU 2491 2521 8.07e-2 SMART
NEBU 2526 2556 1.92e-8 SMART
NEBU 2561 2591 1.08e-2 SMART
NEBU 2596 2626 7.07e-7 SMART
NEBU 2627 2657 2.39e-4 SMART
NEBU 2658 2688 2.39e-4 SMART
NEBU 2689 2719 5.97e-5 SMART
NEBU 2720 2750 2.08e-4 SMART
NEBU 2751 2781 1.02e-3 SMART
NEBU 2787 2817 2.14e-6 SMART
NEBU 2822 2852 1.66e0 SMART
low complexity region 2902 2916 N/A INTRINSIC
SH3 2988 3044 5.11e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036934
AA Change: T5367A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000047763
Gene: ENSMUSG00000026950
AA Change: T5367A

DomainStartEndE-ValueType
low complexity region 4 39 N/A INTRINSIC
low complexity region 47 60 N/A INTRINSIC
NEBU 71 102 3.88e-4 SMART
NEBU 108 138 4e-6 SMART
NEBU 143 173 2.3e-6 SMART
NEBU 178 208 2.06e-8 SMART
NEBU 213 243 1.58e-4 SMART
NEBU 248 278 6.01e-10 SMART
NEBU 284 313 1.14e-1 SMART
NEBU 319 349 6.5e-6 SMART
NEBU 358 388 4.39e-3 SMART
NEBU 393 423 6.01e0 SMART
NEBU 429 459 5.12e-4 SMART
NEBU 497 527 5.74e-7 SMART
NEBU 532 562 5.83e-8 SMART
NEBU 568 598 7.69e-8 SMART
NEBU 606 636 2.87e-7 SMART
NEBU 676 706 3.1e-3 SMART
NEBU 744 774 4.59e-6 SMART
NEBU 779 809 9.47e-8 SMART
NEBU 815 845 7.69e-8 SMART
NEBU 853 883 1.17e-7 SMART
NEBU 888 918 4.74e-8 SMART
NEBU 919 949 9.47e-8 SMART
NEBU 954 985 2.05e-3 SMART
NEBU 988 1018 2.11e-5 SMART
NEBU 1023 1053 8.7e-7 SMART
NEBU 1059 1089 8.7e-7 SMART
NEBU 1097 1127 8.25e-8 SMART
NEBU 1132 1162 8e-6 SMART
NEBU 1163 1193 3.79e-7 SMART
NEBU 1199 1229 8.65e-2 SMART
NEBU 1232 1262 1.05e-9 SMART
NEBU 1267 1297 1.92e-8 SMART
NEBU 1303 1333 7.35e-5 SMART
NEBU 1341 1371 9.33e-7 SMART
NEBU 1376 1406 1.18e-3 SMART
NEBU 1407 1437 7.88e-5 SMART
NEBU 1443 1473 1.33e-2 SMART
NEBU 1476 1506 9.47e-8 SMART
NEBU 1511 1541 7.18e-8 SMART
NEBU 1547 1577 7.46e-6 SMART
NEBU 1585 1615 1.07e-6 SMART
NEBU 1620 1650 3.56e-3 SMART
NEBU 1651 1681 9.33e-7 SMART
NEBU 1687 1717 5.36e-7 SMART
NEBU 1720 1750 1.4e-1 SMART
NEBU 1755 1785 3.59e-8 SMART
NEBU 1791 1821 8e-6 SMART
NEBU 1829 1859 1.92e-8 SMART
NEBU 1864 1894 1.61e-1 SMART
NEBU 1895 1925 6.15e-7 SMART
NEBU 1931 1961 2.02e-2 SMART
NEBU 1964 1994 1.77e-7 SMART
NEBU 1999 2029 1.02e-7 SMART
NEBU 2035 2065 3.25e-6 SMART
NEBU 2073 2103 1.18e-8 SMART
NEBU 2108 2138 2.7e-3 SMART
NEBU 2139 2169 4.85e-5 SMART
NEBU 2175 2205 1.22e-1 SMART
NEBU 2208 2238 2.94e-4 SMART
NEBU 2243 2273 1.67e-8 SMART
NEBU 2279 2309 5.12e-4 SMART
NEBU 2317 2347 1.36e-8 SMART
NEBU 2352 2382 4.85e-5 SMART
NEBU 2383 2413 8.57e-6 SMART
NEBU 2418 2448 1.24e-2 SMART
NEBU 2451 2481 2.09e-9 SMART
NEBU 2486 2516 4e-6 SMART
NEBU 2522 2552 6.5e-6 SMART
NEBU 2560 2590 4.06e-7 SMART
NEBU 2595 2625 2.39e-4 SMART
NEBU 2626 2656 3.43e-5 SMART
NEBU 2661 2691 1.48e0 SMART
NEBU 2694 2724 1.84e-5 SMART
NEBU 2729 2759 3.53e-7 SMART
NEBU 2765 2795 3.15e-4 SMART
NEBU 2803 2833 1.23e-6 SMART
NEBU 2838 2868 2.39e-4 SMART
NEBU 2869 2899 5.97e-5 SMART
NEBU 2904 2934 1.33e-2 SMART
NEBU 2937 2967 1.21e-5 SMART
NEBU 2972 3002 8.32e-4 SMART
NEBU 3008 3038 1.04e-4 SMART
NEBU 3046 3076 4.06e-7 SMART
NEBU 3081 3111 3.73e-6 SMART
NEBU 3112 3142 1.28e-4 SMART
NEBU 3147 3177 3.76e-2 SMART
NEBU 3180 3210 3.25e-6 SMART
NEBU 3215 3245 5.97e-5 SMART
NEBU 3251 3281 2.39e-4 SMART
NEBU 3289 3319 3.3e-7 SMART
NEBU 3324 3354 3.94e-5 SMART
NEBU 3355 3385 1.28e-4 SMART
NEBU 3390 3420 3.76e-2 SMART
NEBU 3423 3453 3.25e-6 SMART
NEBU 3458 3488 2.94e-4 SMART
NEBU 3494 3524 1.84e-5 SMART
NEBU 3532 3562 5.2e-5 SMART
NEBU 3567 3597 3.53e-7 SMART
NEBU 3598 3628 1.32e-6 SMART
NEBU 3633 3663 2.32e-2 SMART
NEBU 3666 3696 5.2e-5 SMART
NEBU 3701 3731 1.15e-6 SMART
NEBU 3737 3767 1.81e-4 SMART
NEBU 3775 3805 4.06e-7 SMART
NEBU 3810 3840 3.73e-6 SMART
NEBU 3841 3871 1.97e-5 SMART
NEBU 3876 3906 2.66e-2 SMART
NEBU 3909 3939 8.12e-7 SMART
NEBU 3944 3974 1.1e-8 SMART
NEBU 3980 4010 2.99e-5 SMART
NEBU 4018 4048 1.07e-6 SMART
NEBU 4053 4083 3.94e-5 SMART
NEBU 4084 4114 2.42e-5 SMART
NEBU 4118 4149 2.66e-2 SMART
NEBU 4152 4182 3.64e-9 SMART
NEBU 4187 4217 1.44e-7 SMART
NEBU 4223 4253 2.87e-7 SMART
NEBU 4261 4291 2.83e-6 SMART
NEBU 4296 4326 5.66e-6 SMART
NEBU 4327 4357 6.06e-6 SMART
NEBU 4361 4392 1.34e1 SMART
NEBU 4395 4425 2.06e-8 SMART
NEBU 4430 4460 1.67e-8 SMART
NEBU 4465 4495 8.57e-6 SMART
NEBU 4502 4533 8.47e0 SMART
NEBU 4538 4568 5.2e-5 SMART
NEBU 4569 4599 1.07e-6 SMART
NEBU 4604 4634 9.55e-4 SMART
NEBU 4637 4667 6.21e-3 SMART
NEBU 4672 4701 4.89e-1 SMART
NEBU 4707 4737 4.7e-3 SMART
NEBU 4745 4775 1.16e-2 SMART
NEBU 4780 4810 5.32e-2 SMART
NEBU 4811 4841 3.62e-4 SMART
NEBU 4846 4876 1.88e-2 SMART
NEBU 4881 4911 1.59e-9 SMART
NEBU 4916 4946 2.7e-3 SMART
NEBU 4952 4982 4.93e0 SMART
NEBU 4990 5020 2.89e1 SMART
NEBU 5025 5055 1.94e-4 SMART
NEBU 5056 5086 3.2e-5 SMART
NEBU 5091 5121 3.71e-1 SMART
NEBU 5126 5156 1.52e-6 SMART
NEBU 5161 5191 4.56e-1 SMART
NEBU 5197 5227 2.39e-4 SMART
NEBU 5235 5265 1.59e1 SMART
NEBU 5270 5300 4.32e-2 SMART
NEBU 5301 5331 4.39e0 SMART
NEBU 5336 5366 5.04e-3 SMART
NEBU 5371 5401 8.78e-3 SMART
NEBU 5407 5437 6.02e-1 SMART
NEBU 5442 5472 5.24e-1 SMART
NEBU 5478 5508 1.53e-2 SMART
NEBU 5513 5543 1.94e-4 SMART
NEBU 5548 5578 1.16e-2 SMART
NEBU 5583 5613 2.51e1 SMART
NEBU 5618 5648 2.81e-1 SMART
NEBU 5653 5683 7.64e-3 SMART
NEBU 5688 5718 5.62e-1 SMART
NEBU 5723 5753 1.49e-5 SMART
NEBU 5758 5788 3.97e-1 SMART
NEBU 5793 5823 1.47e-4 SMART
NEBU 5828 5858 6.45e-1 SMART
NEBU 5863 5893 1.28e-4 SMART
NEBU 5898 5928 9.33e-7 SMART
NEBU 5933 5963 7.58e-7 SMART
NEBU 5969 5999 1.94e-4 SMART
NEBU 6004 6034 9.93e-2 SMART
NEBU 6039 6069 2.45e-1 SMART
NEBU 6074 6104 8.39e-1 SMART
NEBU 6109 6139 1e-6 SMART
NEBU 6146 6176 7.35e-5 SMART
NEBU 6183 6213 1.37e-4 SMART
NEBU 6217 6247 2.83e-6 SMART
NEBU 6252 6282 1.52e-6 SMART
NEBU 6289 6319 5.21e0 SMART
NEBU 6324 6354 7.53e-2 SMART
NEBU 6359 6389 2.5e-7 SMART
NEBU 6392 6424 1.16e-2 SMART
NEBU 6431 6461 1.47e-4 SMART
NEBU 6468 6498 3.2e-5 SMART
NEBU 6506 6536 8.07e-2 SMART
NEBU 6541 6571 1.92e-8 SMART
NEBU 6576 6606 1.08e-2 SMART
NEBU 6611 6641 7.07e-7 SMART
NEBU 6642 6672 2.39e-4 SMART
NEBU 6673 6703 2.39e-4 SMART
NEBU 6704 6734 5.97e-5 SMART
NEBU 6735 6765 4.46e-4 SMART
NEBU 6766 6796 2.18e-7 SMART
NEBU 6797 6827 2.64e-6 SMART
NEBU 6828 6858 6.96e-6 SMART
NEBU 6859 6889 6.3e-4 SMART
NEBU 6895 6925 2.14e-6 SMART
NEBU 6930 6960 1.66e0 SMART
low complexity region 7010 7024 N/A INTRINSIC
SH3 7096 7152 5.11e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000075301
AA Change: T5124A

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000074773
Gene: ENSMUSG00000026950
AA Change: T5124A

DomainStartEndE-ValueType
low complexity region 4 39 N/A INTRINSIC
low complexity region 47 60 N/A INTRINSIC
NEBU 71 102 3.88e-4 SMART
NEBU 108 138 4e-6 SMART
NEBU 143 173 2.3e-6 SMART
NEBU 178 208 2.06e-8 SMART
NEBU 213 243 1.58e-4 SMART
NEBU 248 278 6.01e-10 SMART
NEBU 284 313 1.14e-1 SMART
NEBU 319 349 6.5e-6 SMART
NEBU 358 388 4.39e-3 SMART
NEBU 393 423 6.01e0 SMART
NEBU 429 459 5.12e-4 SMART
NEBU 497 527 5.74e-7 SMART
NEBU 532 562 5.83e-8 SMART
NEBU 568 598 7.69e-8 SMART
NEBU 606 636 2.87e-7 SMART
NEBU 676 706 3.1e-3 SMART
NEBU 744 774 4.59e-6 SMART
NEBU 779 809 9.47e-8 SMART
NEBU 815 845 7.69e-8 SMART
NEBU 853 883 1.17e-7 SMART
NEBU 888 918 4.74e-8 SMART
NEBU 919 949 9.47e-8 SMART
NEBU 954 985 2.05e-3 SMART
NEBU 988 1018 2.11e-5 SMART
NEBU 1023 1053 8.7e-7 SMART
NEBU 1059 1089 8.7e-7 SMART
NEBU 1097 1127 8.25e-8 SMART
NEBU 1132 1162 8e-6 SMART
NEBU 1163 1193 3.79e-7 SMART
NEBU 1199 1229 8.65e-2 SMART
NEBU 1232 1262 1.05e-9 SMART
NEBU 1267 1297 1.92e-8 SMART
NEBU 1303 1333 7.35e-5 SMART
NEBU 1341 1371 9.33e-7 SMART
NEBU 1376 1406 1.18e-3 SMART
NEBU 1407 1437 7.88e-5 SMART
NEBU 1443 1473 1.33e-2 SMART
NEBU 1476 1506 9.47e-8 SMART
NEBU 1511 1541 7.18e-8 SMART
NEBU 1547 1577 7.46e-6 SMART
NEBU 1585 1615 1.07e-6 SMART
NEBU 1620 1650 3.56e-3 SMART
NEBU 1651 1681 9.33e-7 SMART
NEBU 1687 1717 5.36e-7 SMART
NEBU 1720 1750 1.4e-1 SMART
NEBU 1755 1785 3.59e-8 SMART
NEBU 1791 1821 8e-6 SMART
NEBU 1829 1859 1.92e-8 SMART
NEBU 1864 1894 1.61e-1 SMART
NEBU 1895 1925 6.15e-7 SMART
NEBU 1931 1961 2.02e-2 SMART
NEBU 1964 1994 1.77e-7 SMART
NEBU 1999 2029 1.02e-7 SMART
NEBU 2035 2065 3.25e-6 SMART
NEBU 2073 2103 1.18e-8 SMART
NEBU 2108 2138 2.7e-3 SMART
NEBU 2139 2169 4.85e-5 SMART
NEBU 2175 2205 1.22e-1 SMART
NEBU 2208 2238 2.94e-4 SMART
NEBU 2243 2273 1.67e-8 SMART
NEBU 2279 2309 5.12e-4 SMART
NEBU 2317 2347 1.36e-8 SMART
NEBU 2352 2382 4.85e-5 SMART
NEBU 2383 2413 8.57e-6 SMART
NEBU 2418 2448 1.24e-2 SMART
NEBU 2451 2481 2.09e-9 SMART
NEBU 2486 2516 4e-6 SMART
NEBU 2522 2552 6.5e-6 SMART
NEBU 2560 2590 4.06e-7 SMART
NEBU 2595 2625 2.39e-4 SMART
NEBU 2626 2656 3.43e-5 SMART
NEBU 2661 2691 1.48e0 SMART
NEBU 2694 2724 1.84e-5 SMART
NEBU 2729 2759 3.53e-7 SMART
NEBU 2765 2795 3.15e-4 SMART
NEBU 2803 2833 1.23e-6 SMART
NEBU 2838 2868 2.39e-4 SMART
NEBU 2869 2899 5.97e-5 SMART
NEBU 2904 2934 1.33e-2 SMART
NEBU 2937 2967 1.21e-5 SMART
NEBU 2972 3002 8.32e-4 SMART
NEBU 3008 3038 1.04e-4 SMART
NEBU 3046 3076 4.06e-7 SMART
NEBU 3081 3111 3.73e-6 SMART
NEBU 3112 3142 1.28e-4 SMART
NEBU 3147 3177 3.76e-2 SMART
NEBU 3180 3210 3.25e-6 SMART
NEBU 3215 3245 5.97e-5 SMART
NEBU 3251 3281 2.39e-4 SMART
NEBU 3289 3319 3.3e-7 SMART
NEBU 3324 3354 3.94e-5 SMART
NEBU 3355 3385 1.28e-4 SMART
NEBU 3390 3420 3.76e-2 SMART
NEBU 3423 3453 3.25e-6 SMART
NEBU 3458 3488 2.94e-4 SMART
NEBU 3494 3524 1.84e-5 SMART
NEBU 3532 3562 5.2e-5 SMART
NEBU 3567 3597 3.53e-7 SMART
NEBU 3598 3628 1.32e-6 SMART
NEBU 3633 3663 2.32e-2 SMART
NEBU 3666 3696 5.2e-5 SMART
NEBU 3701 3731 1.15e-6 SMART
NEBU 3737 3767 1.81e-4 SMART
NEBU 3775 3805 4.06e-7 SMART
NEBU 3810 3840 3.73e-6 SMART
NEBU 3841 3871 1.97e-5 SMART
NEBU 3876 3906 2.66e-2 SMART
NEBU 3909 3939 8.12e-7 SMART
NEBU 3944 3974 1.1e-8 SMART
NEBU 3980 4010 2.99e-5 SMART
NEBU 4018 4048 1.07e-6 SMART
NEBU 4053 4083 3.94e-5 SMART
NEBU 4084 4114 2.83e-6 SMART
NEBU 4118 4149 1.34e1 SMART
NEBU 4152 4182 2.06e-8 SMART
NEBU 4187 4217 1.67e-8 SMART
NEBU 4222 4252 8.57e-6 SMART
NEBU 4259 4290 8.47e0 SMART
NEBU 4295 4325 5.2e-5 SMART
NEBU 4326 4356 1.07e-6 SMART
NEBU 4361 4391 9.55e-4 SMART
NEBU 4394 4424 6.21e-3 SMART
NEBU 4429 4458 4.89e-1 SMART
NEBU 4464 4494 4.7e-3 SMART
NEBU 4502 4532 1.16e-2 SMART
NEBU 4537 4567 5.32e-2 SMART
NEBU 4568 4598 3.62e-4 SMART
NEBU 4603 4633 1.88e-2 SMART
NEBU 4638 4668 1.59e-9 SMART
NEBU 4673 4703 2.7e-3 SMART
NEBU 4709 4739 4.93e0 SMART
NEBU 4747 4777 2.89e1 SMART
NEBU 4782 4812 1.94e-4 SMART
NEBU 4813 4843 3.2e-5 SMART
NEBU 4848 4878 3.71e-1 SMART
NEBU 4883 4913 1.52e-6 SMART
NEBU 4918 4948 4.56e-1 SMART
NEBU 4954 4984 2.39e-4 SMART
NEBU 4992 5022 1.59e1 SMART
NEBU 5027 5057 4.32e-2 SMART
NEBU 5058 5088 4.39e0 SMART
NEBU 5093 5123 5.04e-3 SMART
NEBU 5128 5158 8.78e-3 SMART
NEBU 5164 5194 6.02e-1 SMART
NEBU 5199 5229 5.24e-1 SMART
NEBU 5235 5265 1.53e-2 SMART
NEBU 5270 5300 1.94e-4 SMART
NEBU 5305 5335 1.16e-2 SMART
NEBU 5340 5370 2.51e1 SMART
NEBU 5375 5405 2.81e-1 SMART
NEBU 5410 5440 7.64e-3 SMART
NEBU 5445 5475 5.62e-1 SMART
NEBU 5480 5510 1.49e-5 SMART
NEBU 5515 5545 3.97e-1 SMART
NEBU 5550 5580 1.47e-4 SMART
NEBU 5585 5615 6.45e-1 SMART
NEBU 5620 5650 1.28e-4 SMART
NEBU 5655 5685 9.33e-7 SMART
NEBU 5690 5720 7.58e-7 SMART
NEBU 5726 5756 1.94e-4 SMART
NEBU 5761 5791 9.93e-2 SMART
NEBU 5796 5826 2.45e-1 SMART
NEBU 5831 5861 8.39e-1 SMART
NEBU 5866 5896 1e-6 SMART
NEBU 5903 5933 7.35e-5 SMART
NEBU 5940 5970 1.37e-4 SMART
NEBU 5974 6004 2.83e-6 SMART
NEBU 6009 6039 1.52e-6 SMART
NEBU 6046 6076 5.21e0 SMART
NEBU 6081 6111 7.53e-2 SMART
NEBU 6116 6146 2.5e-7 SMART
NEBU 6149 6181 1.16e-2 SMART
NEBU 6188 6218 1.47e-4 SMART
NEBU 6225 6255 3.2e-5 SMART
NEBU 6263 6293 8.07e-2 SMART
NEBU 6298 6328 1.92e-8 SMART
NEBU 6333 6363 1.08e-2 SMART
NEBU 6368 6398 7.07e-7 SMART
NEBU 6399 6429 2.39e-4 SMART
NEBU 6430 6460 2.39e-4 SMART
NEBU 6461 6491 5.97e-5 SMART
NEBU 6492 6522 2.08e-4 SMART
NEBU 6523 6553 2.68e-7 SMART
NEBU 6554 6584 2.64e-6 SMART
NEBU 6585 6615 6.96e-6 SMART
NEBU 6616 6646 6.3e-4 SMART
NEBU 6652 6682 2.14e-6 SMART
NEBU 6687 6717 1.66e0 SMART
low complexity region 6767 6781 N/A INTRINSIC
SH3 6853 6909 5.11e-14 SMART
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes nebulin, a giant protein component of the cytoskeletal matrix that coexists with the thick and thin filaments within the sarcomeres of skeletal muscle. In most vertebrates, nebulin accounts for 3 to 4% of the total myofibrillar protein. The encoded protein contains approximately 30-amino acid long modules that can be classified into 7 types and other repeated modules. Protein isoform sizes vary from 600 to 800 kD due to alternative splicing that is tissue-, species-,and developmental stage-specific. Of the 183 exons in the nebulin gene, at least 43 are alternatively spliced, although exons 143 and 144 are not found in the same transcript. Of the several thousand transcript variants predicted for nebulin, the RefSeq Project has decided to create three representative RefSeq records. Mutations in this gene are associated with recessive nemaline myopathy. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous inactivation of this gene leads to stunted growth, altered sarcomere structure, reduced contractility in skeletal muscle, progressive muscle weakness, and postnatal death. Observed phenotypes may include a stiff gait, blepharoptosis, kyphosis, abnormal suckling, and reduced adiposity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 164 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A G 10: 28,983,926 probably null Het
Aadacl3 A G 4: 144,456,232 I222T probably damaging Het
Abca13 G T 11: 9,522,341 G4249V possibly damaging Het
Abcb10 A G 8: 123,966,527 V346A probably benign Het
Abcc2 A T 19: 43,819,361 I814F probably damaging Het
AF366264 T A 8: 13,836,970 I374F possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd28 A C 14: 31,736,830 D335E probably damaging Het
Ankrd44 T C 1: 54,762,316 H284R probably damaging Het
Arfgef3 G T 10: 18,591,906 Q1849K probably benign Het
Atp2c2 T C 8: 119,747,687 M490T probably damaging Het
Bach1 T A 16: 87,722,452 D543E probably damaging Het
Bahcc1 G A 11: 120,282,225 V1558I probably benign Het
Bbs5 T A 2: 69,655,614 W168R probably damaging Het
Bcar3 A T 3: 122,529,594 D766V probably benign Het
C1ra A G 6: 124,513,768 D40G probably benign Het
Ccdc138 G A 10: 58,573,643 C598Y probably damaging Het
Cd200r3 T A 16: 44,957,825 N197K possibly damaging Het
Cenpf T A 1: 189,651,220 E2634D probably damaging Het
Cisd2 T C 3: 135,411,141 K63R probably damaging Het
Clca3a2 A T 3: 144,807,351 S478T possibly damaging Het
Clptm1l T C 13: 73,607,862 M199T possibly damaging Het
Cntnap4 T A 8: 112,773,590 S505T possibly damaging Het
Cr2 C T 1: 195,163,311 G112D probably damaging Het
Crb2 T A 2: 37,793,756 I1090N probably benign Het
Csmd3 G T 15: 47,621,292 P3057Q probably damaging Het
Ctso G A 3: 81,954,240 V307I probably damaging Het
Cyp3a41b T A 5: 145,573,651 T138S probably benign Het
Dctn3 G T 4: 41,719,904 Y67* probably null Het
Dennd4c C A 4: 86,819,884 Y967* probably null Het
Dlg5 C T 14: 24,154,689 G1262D probably damaging Het
Dnaaf1 G A 8: 119,577,361 G46D probably benign Het
Dnah6 A G 6: 73,089,698 V2563A probably damaging Het
Dnajc13 A G 9: 104,175,727 Y1679H probably benign Het
Eif2ak3 T C 6: 70,887,893 Y578H probably benign Het
Endod1 C T 9: 14,357,023 V389M probably benign Het
Ephb4 T C 5: 137,365,506 L591P probably damaging Het
Eps15 T C 4: 109,324,217 L316S possibly damaging Het
Erbb4 G T 1: 68,330,246 T412K probably damaging Het
Fam117a T A 11: 95,364,070 F90I probably damaging Het
Fam187b T G 7: 30,977,090 V8G possibly damaging Het
Fam84b C A 15: 60,823,944 probably benign Het
Far1 T A 7: 113,539,453 I59N possibly damaging Het
Fbxo34 T A 14: 47,530,869 L613Q probably damaging Het
Frem1 T A 4: 82,916,628 probably benign Het
Gfra3 G T 18: 34,720,192 P10Q probably damaging Het
Gm10698 A G 9: 33,728,772 noncoding transcript Het
Gm11487 C T 4: 73,401,267 W324* probably null Het
Gm19965 T A 1: 116,821,896 Y436N probably benign Het
Gm21818 T A 13: 120,173,222 S13R probably benign Het
Gm5767 A G 16: 8,683,345 T22A probably benign Het
Gm5799 A T 14: 43,544,548 H59L probably damaging Het
Gmppb T A 9: 108,050,217 V121E probably benign Het
Ighv7-4 G C 12: 114,223,279 probably benign Het
Ipo4 A G 14: 55,631,214 S446P probably damaging Het
Itpr2 T C 6: 146,371,331 T855A probably damaging Het
Jaml T C 9: 45,101,064 I283T possibly damaging Het
Kcnn2 T C 18: 45,685,267 probably benign Het
Klhl32 T C 4: 24,649,698 Y399C possibly damaging Het
Lrriq1 G A 10: 103,221,318 T207I probably benign Het
Lrriq3 A T 3: 155,187,970 H436L probably benign Het
Mad2l1bp T C 17: 46,148,263 K114E possibly damaging Het
Mamstr T C 7: 45,642,418 V64A possibly damaging Het
Map4 T A 9: 110,035,257 S517T probably benign Het
Matn1 A T 4: 130,950,025 I182F possibly damaging Het
Mcm3 A G 1: 20,810,156 I484T probably damaging Het
Med13 T A 11: 86,278,773 I1922F probably damaging Het
Metap2 A G 10: 93,868,895 V137A probably damaging Het
Mex3d A G 10: 80,386,954 V156A possibly damaging Het
Mfsd6 G A 1: 52,709,596 P37S probably benign Het
Mkl1 T C 15: 81,104,799 E7G probably benign Het
Mrgprx1 A C 7: 48,021,211 S263A possibly damaging Het
Msl1 C T 11: 98,803,969 R521* probably null Het
Mta2 T C 19: 8,945,851 S96P probably damaging Het
Mtr A T 13: 12,195,251 N986K probably benign Het
Mut A G 17: 40,937,351 T90A probably benign Het
Mutyh C T 4: 116,817,029 T259I probably benign Het
Myof T C 19: 37,945,738 T908A probably benign Het
Nav2 A T 7: 49,545,852 D992V possibly damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nudt6 G A 3: 37,405,354 R161C probably benign Het
Olfr1122 T A 2: 87,388,209 V168E probably benign Het
Olfr1173 T A 2: 88,274,879 M57L probably damaging Het
Olfr125 T C 17: 37,835,349 Y117H probably damaging Het
Olfr1276 T A 2: 111,257,152 F12L probably damaging Het
Olfr1411 T A 1: 92,596,998 C160S probably benign Het
Olfr154 T A 2: 85,664,278 D52V probably damaging Het
Olfr23 T A 11: 73,940,870 I208K possibly damaging Het
Olfr319 T C 11: 58,701,791 V30A probably benign Het
Olfr456 A T 6: 42,486,679 N171K probably benign Het
Olfr744 A G 14: 50,619,022 T267A probably benign Het
Olfr959 T G 9: 39,572,858 M134L probably benign Het
Olr1 A G 6: 129,488,090 F141S possibly damaging Het
Oprl1 G T 2: 181,719,253 M340I probably benign Het
Otogl A C 10: 107,901,336 C72W probably damaging Het
Pcdha11 T A 18: 37,005,465 I49N probably damaging Het
Pcdha4 T A 18: 36,953,955 L397* probably null Het
Pcdhb14 A G 18: 37,448,278 S146G probably benign Het
Pclo T A 5: 14,675,815 H1562Q unknown Het
Pcsk9 T C 4: 106,447,569 E434G probably benign Het
Phc2 A G 4: 128,751,598 K833E probably damaging Het
Pja2 A T 17: 64,292,862 S480R probably damaging Het
Pkd1 G A 17: 24,578,096 G2493D probably damaging Het
Plk5 G A 10: 80,359,304 V179M possibly damaging Het
Polr1a G A 6: 71,976,070 V1541I probably benign Het
Ppard C G 17: 28,286,374 R12G unknown Het
Ppp1r14a A G 7: 29,291,526 D73G probably damaging Het
Psd3 C T 8: 68,121,148 R127H probably benign Het
Pten G T 19: 32,758,503 G20V possibly damaging Het
Ptprg T C 14: 11,554,233 probably benign Het
Rad54l T C 4: 116,122,924 D21G probably null Het
Rgs14 T C 13: 55,380,957 Y304H probably damaging Het
Rgs9 T C 11: 109,240,868 K346R probably damaging Het
Rnf169 C G 7: 99,926,446 G314A probably damaging Het
Rpgrip1l T A 8: 91,270,177 T692S probably damaging Het
Rtf1 T C 2: 119,675,228 V54A possibly damaging Het
Rtn4 T C 11: 29,708,660 V938A probably benign Het
Ryr2 T A 13: 11,687,932 D2890V probably damaging Het
Ryr2 T C 13: 11,708,227 T2509A probably damaging Het
Scel A C 14: 103,583,100 T368P probably benign Het
Scgb1b2 G T 7: 31,291,573 L37I possibly damaging Het
Sdf4 A G 4: 156,000,721 H171R possibly damaging Het
Sec31a A G 5: 100,393,363 V295A probably damaging Het
Setx T A 2: 29,146,373 S957T probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Six5 A G 7: 19,096,969 N507S probably benign Het
Slc12a7 T C 13: 73,763,892 probably null Het
Slc1a7 T A 4: 107,993,040 V116E probably damaging Het
Slc22a1 A G 17: 12,675,535 L42P probably damaging Het
Slc25a31 A T 3: 40,721,545 I174F probably damaging Het
Slc31a2 A T 4: 62,292,632 M3L probably damaging Het
Slco1a4 T A 6: 141,845,497 probably benign Het
Smcr8 C T 11: 60,778,610 L195F probably null Het
Smg5 G T 3: 88,355,692 E801* probably null Het
Smgc C A 15: 91,854,616 H492Q probably benign Het
Smyd4 G T 11: 75,403,184 G694V probably damaging Het
Sorcs3 A G 19: 48,398,744 T223A possibly damaging Het
Stab1 G T 14: 31,141,371 C2119* probably null Het
Taar9 A G 10: 24,108,843 I231T probably damaging Het
Tacr2 A G 10: 62,261,548 Y269C probably damaging Het
Taf3 T G 2: 9,951,123 K744N possibly damaging Het
Tenm4 T A 7: 96,906,245 V2682E probably damaging Het
Tet1 A C 10: 62,822,663 L1468R probably damaging Het
Tgds T C 14: 118,117,033 probably benign Het
Tgfb2 A T 1: 186,628,913 Y380* probably null Het
Tgm5 T G 2: 121,052,472 K435Q probably damaging Het
Themis A G 10: 28,761,511 T204A probably benign Het
Tm4sf1 T C 3: 57,294,679 Y37C probably damaging Het
Tnn T C 1: 160,145,033 N333S possibly damaging Het
Tppp2 A G 14: 51,919,348 N61D probably benign Het
Treml2 A G 17: 48,309,159 T276A probably benign Het
Trit1 T C 4: 123,016,638 V10A probably benign Het
Uba1y T G Y: 825,890 probably null Het
Uqcc1 T C 2: 155,858,106 probably benign Het
Vcam1 C G 3: 116,115,935 G581A probably damaging Het
Vmn1r16 G A 6: 57,323,190 T149I probably benign Het
Vmn1r209 T C 13: 22,805,656 D288G probably damaging Het
Vmn1r78 T A 7: 12,152,964 Y167* probably null Het
Vmn2r103 T A 17: 19,795,076 S493T probably benign Het
Vmn2r105 T A 17: 20,227,294 M423L probably benign Het
Vps13c T C 9: 67,964,282 F3244L probably damaging Het
Zfp119b A T 17: 55,939,642 D149E probably damaging Het
Zfp345 T C 2: 150,473,308 Y103C possibly damaging Het
Zmym6 C T 4: 127,123,216 T930I probably benign Het
Other mutations in Neb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Neb APN 2 52308747 missense possibly damaging 0.55
IGL00232:Neb APN 2 52235556 missense possibly damaging 0.83
IGL00501:Neb APN 2 52295344 missense probably benign 0.02
IGL00548:Neb APN 2 52243972 missense probably benign 0.33
IGL00556:Neb APN 2 52191949 missense probably benign 0.16
IGL00561:Neb APN 2 52206105 missense probably benign 0.00
IGL00598:Neb APN 2 52208301 missense possibly damaging 0.62
IGL00788:Neb APN 2 52205732 unclassified probably benign
IGL00817:Neb APN 2 52243195 unclassified probably damaging 1.00
IGL00926:Neb APN 2 52270317 unclassified probably benign
IGL00975:Neb APN 2 52212728 missense probably benign 0.01
IGL01012:Neb APN 2 52196361 missense probably benign
IGL01014:Neb APN 2 52287158 missense probably benign 0.11
IGL01419:Neb APN 2 52226533 nonsense probably null
IGL01420:Neb APN 2 52157377 missense probably damaging 1.00
IGL01459:Neb APN 2 52176792 missense probably damaging 1.00
IGL01467:Neb APN 2 52159487 missense possibly damaging 0.55
IGL01474:Neb APN 2 52328905 missense unknown
IGL01506:Neb APN 2 52247190 missense probably damaging 1.00
IGL01544:Neb APN 2 52292905 unclassified possibly damaging 0.62
IGL01608:Neb APN 2 52170536 missense probably damaging 1.00
IGL01681:Neb APN 2 52201486 missense probably damaging 1.00
IGL01717:Neb APN 2 52189867 missense probably damaging 1.00
IGL01743:Neb APN 2 52225667 missense probably damaging 1.00
IGL01774:Neb APN 2 52222970 nonsense probably null
IGL01787:Neb APN 2 52296355 missense possibly damaging 0.56
IGL01822:Neb APN 2 52258746 missense possibly damaging 0.68
IGL01844:Neb APN 2 52170549 unclassified probably benign 0.01
IGL01871:Neb APN 2 52153069 missense probably damaging 0.99
IGL01878:Neb APN 2 52169840 unclassified probably benign
IGL01886:Neb APN 2 52183845 unclassified probably benign
IGL01897:Neb APN 2 52280575 missense possibly damaging 0.88
IGL02025:Neb APN 2 52307739 missense probably benign 0.17
IGL02133:Neb APN 2 52212804 unclassified probably null
IGL02143:Neb APN 2 52291199 missense probably damaging 0.99
IGL02212:Neb APN 2 52308311 missense probably damaging 1.00
IGL02216:Neb APN 2 52226490 unclassified probably null
IGL02260:Neb APN 2 52205656 missense probably damaging 1.00
IGL02364:Neb APN 2 52296254 nonsense probably null
IGL02424:Neb APN 2 52264191 missense probably damaging 1.00
IGL02449:Neb APN 2 52201906 missense probably benign 0.00
IGL02465:Neb APN 2 52193165 unclassified probably benign
IGL02475:Neb APN 2 52292819 missense probably damaging 1.00
IGL02486:Neb APN 2 52282603 missense possibly damaging 0.86
IGL02527:Neb APN 2 52263947 missense probably damaging 1.00
IGL02527:Neb APN 2 52149213 missense probably benign 0.36
IGL02547:Neb APN 2 52188730 missense probably damaging 1.00
IGL02648:Neb APN 2 52271081 missense possibly damaging 0.79
IGL02685:Neb APN 2 52175301 missense possibly damaging 0.93
IGL02695:Neb APN 2 52255591 missense probably damaging 1.00
IGL02695:Neb APN 2 52211596 unclassified probably benign
IGL02731:Neb APN 2 52160703 missense probably damaging 1.00
IGL02738:Neb APN 2 52243850 missense probably damaging 0.99
IGL02750:Neb APN 2 52291055 missense probably benign 0.00
IGL02879:Neb APN 2 52256685 missense possibly damaging 0.95
IGL02887:Neb APN 2 52200721 missense possibly damaging 0.67
IGL02975:Neb APN 2 52298867 missense probably damaging 0.99
IGL03009:Neb APN 2 52179456 unclassified probably benign
IGL03036:Neb APN 2 52244153 unclassified probably damaging 1.00
IGL03076:Neb APN 2 52169088 missense probably damaging 0.99
IGL03091:Neb APN 2 52271312 missense probably benign 0.08
IGL03095:Neb APN 2 52169088 missense probably damaging 0.99
IGL03096:Neb APN 2 52249472 missense possibly damaging 0.59
IGL03107:Neb APN 2 52183825 missense probably benign 0.41
IGL03171:Neb APN 2 52216364 unclassified probably benign
IGL03179:Neb APN 2 52176641 missense probably damaging 1.00
IGL03186:Neb APN 2 52169088 missense probably damaging 0.99
IGL03186:Neb APN 2 52210659 unclassified probably benign
IGL03187:Neb APN 2 52169088 missense probably damaging 0.99
IGL03209:Neb APN 2 52290819 missense probably damaging 1.00
IGL03214:Neb APN 2 52159548 missense probably damaging 1.00
IGL03214:Neb APN 2 52197844 missense possibly damaging 0.75
IGL03233:Neb APN 2 52308301 missense possibly damaging 0.93
IGL03287:Neb APN 2 52137323 missense probably damaging 1.00
IGL03349:Neb APN 2 52278952 missense possibly damaging 0.88
IGL03369:Neb APN 2 52178037 missense probably benign
IGL03382:Neb APN 2 52325708 missense probably benign 0.00
IGL03410:Neb APN 2 52319705 missense probably benign 0.00
IGL03411:Neb APN 2 52292878 missense probably benign
IGL03054:Neb UTSW 2 52271322 missense probably damaging 1.00
R0014:Neb UTSW 2 52287156 missense probably damaging 0.99
R0014:Neb UTSW 2 52287156 missense probably damaging 0.99
R0025:Neb UTSW 2 52222774 missense probably damaging 0.99
R0049:Neb UTSW 2 52170467 missense possibly damaging 0.86
R0049:Neb UTSW 2 52170467 missense possibly damaging 0.86
R0052:Neb UTSW 2 52273980 missense possibly damaging 0.62
R0066:Neb UTSW 2 52306530 missense probably damaging 1.00
R0066:Neb UTSW 2 52306530 missense probably damaging 1.00
R0097:Neb UTSW 2 52204894 missense probably damaging 1.00
R0097:Neb UTSW 2 52204894 missense probably damaging 1.00
R0110:Neb UTSW 2 52290743 splice site probably benign
R0147:Neb UTSW 2 52249376 missense probably damaging 0.99
R0148:Neb UTSW 2 52249376 missense probably damaging 0.99
R0173:Neb UTSW 2 52243847 missense probably damaging 1.00
R0201:Neb UTSW 2 52206878 splice site probably benign
R0254:Neb UTSW 2 52243390 missense probably damaging 1.00
R0295:Neb UTSW 2 52284285 missense possibly damaging 0.90
R0314:Neb UTSW 2 52243331 missense probably benign 0.01
R0316:Neb UTSW 2 52195470 missense possibly damaging 0.96
R0380:Neb UTSW 2 52232202 missense probably damaging 1.00
R0389:Neb UTSW 2 52161477 critical splice acceptor site probably null
R0394:Neb UTSW 2 52177559 unclassified probably null
R0401:Neb UTSW 2 52188677 splice site probably benign
R0413:Neb UTSW 2 52290739 splice site probably benign
R0427:Neb UTSW 2 52243884 missense possibly damaging 0.83
R0427:Neb UTSW 2 52244069 missense probably damaging 0.98
R0443:Neb UTSW 2 52161477 critical splice acceptor site probably null
R0453:Neb UTSW 2 52313890 splice site probably null
R0468:Neb UTSW 2 52211556 missense probably damaging 0.96
R0510:Neb UTSW 2 52290743 splice site probably benign
R0513:Neb UTSW 2 52308687 missense probably damaging 0.98
R0590:Neb UTSW 2 52137290 missense probably damaging 0.99
R0605:Neb UTSW 2 52264026 missense possibly damaging 0.92
R0608:Neb UTSW 2 52326757 missense probably benign 0.19
R0622:Neb UTSW 2 52212951 missense probably benign 0.09
R0639:Neb UTSW 2 52256124 missense possibly damaging 0.47
R0656:Neb UTSW 2 52225558 splice site probably benign
R0670:Neb UTSW 2 52256124 missense possibly damaging 0.47
R0673:Neb UTSW 2 52256124 missense possibly damaging 0.47
R0732:Neb UTSW 2 52258681 missense probably damaging 1.00
R0732:Neb UTSW 2 52291268 missense probably damaging 1.00
R0736:Neb UTSW 2 52192012 missense probably damaging 1.00
R0764:Neb UTSW 2 52216867 splice site probably benign
R0811:Neb UTSW 2 52292695 missense possibly damaging 0.89
R0812:Neb UTSW 2 52292695 missense possibly damaging 0.89
R0839:Neb UTSW 2 52277548 missense probably damaging 0.99
R0960:Neb UTSW 2 52212983 missense probably benign 0.17
R1026:Neb UTSW 2 52264110 missense possibly damaging 0.93
R1076:Neb UTSW 2 52204892 missense probably damaging 1.00
R1170:Neb UTSW 2 52196357 missense probably damaging 1.00
R1184:Neb UTSW 2 52263947 missense probably damaging 1.00
R1185:Neb UTSW 2 52296298 missense probably damaging 1.00
R1185:Neb UTSW 2 52296298 missense probably damaging 1.00
R1185:Neb UTSW 2 52296298 missense probably damaging 1.00
R1200:Neb UTSW 2 52167645 missense probably damaging 1.00
R1205:Neb UTSW 2 52222984 missense probably damaging 0.97
R1208:Neb UTSW 2 52303900 nonsense probably null
R1208:Neb UTSW 2 52303900 nonsense probably null
R1229:Neb UTSW 2 52243943 missense probably damaging 1.00
R1240:Neb UTSW 2 52296309 missense possibly damaging 0.92
R1374:Neb UTSW 2 52243389 missense probably damaging 1.00
R1381:Neb UTSW 2 52260532 missense probably damaging 1.00
R1397:Neb UTSW 2 52243943 missense probably damaging 1.00
R1398:Neb UTSW 2 52289646 missense probably damaging 1.00
R1404:Neb UTSW 2 52183275 missense possibly damaging 0.95
R1404:Neb UTSW 2 52183275 missense possibly damaging 0.95
R1452:Neb UTSW 2 52271297 critical splice donor site probably null
R1467:Neb UTSW 2 52230047 missense probably damaging 1.00
R1467:Neb UTSW 2 52230047 missense probably damaging 1.00
R1477:Neb UTSW 2 52264122 missense probably damaging 0.99
R1478:Neb UTSW 2 52175607 missense probably benign 0.29
R1496:Neb UTSW 2 52328734 missense probably damaging 0.99
R1503:Neb UTSW 2 52298620 missense probably damaging 0.96
R1513:Neb UTSW 2 52227244 missense probably damaging 1.00
R1600:Neb UTSW 2 52271604 missense probably damaging 1.00
R1601:Neb UTSW 2 52287252 nonsense probably null
R1638:Neb UTSW 2 52249281 missense probably benign 0.05
R1712:Neb UTSW 2 52243389 missense probably damaging 1.00
R1717:Neb UTSW 2 52308747 missense possibly damaging 0.55
R1720:Neb UTSW 2 52207721 missense probably benign 0.02
R1722:Neb UTSW 2 52256745 missense probably damaging 1.00
R1765:Neb UTSW 2 52204664 missense probably damaging 1.00
R1772:Neb UTSW 2 52235677 missense probably damaging 1.00
R1782:Neb UTSW 2 52284345 nonsense probably null
R1834:Neb UTSW 2 52236895 missense probably damaging 1.00
R1847:Neb UTSW 2 52196295 missense possibly damaging 0.80
R1852:Neb UTSW 2 52228542 missense probably damaging 0.98
R1862:Neb UTSW 2 52162187 splice site probably null
R1864:Neb UTSW 2 52212760 nonsense probably null
R1868:Neb UTSW 2 52326744 missense probably damaging 0.99
R1880:Neb UTSW 2 52258731 missense probably damaging 0.98
R1906:Neb UTSW 2 52308526 missense probably damaging 1.00
R1926:Neb UTSW 2 52279635 missense probably damaging 1.00
R1944:Neb UTSW 2 52228850 missense probably benign 0.23
R1962:Neb UTSW 2 52272937 nonsense probably null
R1970:Neb UTSW 2 52263905 missense possibly damaging 0.77
R1978:Neb UTSW 2 52287345 missense probably damaging 1.00
R1995:Neb UTSW 2 52298732 missense probably damaging 1.00
R2000:Neb UTSW 2 52212970 nonsense probably null
R2006:Neb UTSW 2 52199444 missense probably null 1.00
R2019:Neb UTSW 2 52232276 nonsense probably null
R2034:Neb UTSW 2 52280611 missense possibly damaging 0.78
R2067:Neb UTSW 2 52284263 missense probably benign 0.16
R2104:Neb UTSW 2 52256814 missense probably benign 0.14
R2104:Neb UTSW 2 52271558 missense probably damaging 1.00
R2111:Neb UTSW 2 52284263 missense probably benign 0.16
R2112:Neb UTSW 2 52328764 missense probably damaging 1.00
R2120:Neb UTSW 2 52264064 missense probably damaging 1.00
R2121:Neb UTSW 2 52264064 missense probably damaging 1.00
R2124:Neb UTSW 2 52264064 missense probably damaging 1.00
R2125:Neb UTSW 2 52310638 missense probably damaging 1.00
R2126:Neb UTSW 2 52310638 missense probably damaging 1.00
R2139:Neb UTSW 2 52212588 missense probably damaging 0.99
R2207:Neb UTSW 2 52211567 nonsense probably null
R2228:Neb UTSW 2 52232995 missense probably benign 0.19
R2352:Neb UTSW 2 52287336 missense probably damaging 1.00
R2374:Neb UTSW 2 52263657 missense probably damaging 1.00
R2413:Neb UTSW 2 52210632 missense probably damaging 1.00
R2424:Neb UTSW 2 52209659 splice site probably benign
R2426:Neb UTSW 2 52169053 splice site probably null
R2508:Neb UTSW 2 52195521 missense probably benign 0.23
R2512:Neb UTSW 2 52210831 missense probably damaging 0.99
R2518:Neb UTSW 2 52249511 nonsense probably null
R2899:Neb UTSW 2 52185323 missense probably benign
R3500:Neb UTSW 2 52325785 missense probably damaging 1.00
R3690:Neb UTSW 2 52137385 missense probably damaging 1.00
R3716:Neb UTSW 2 52277470 missense probably damaging 1.00
R3717:Neb UTSW 2 52277470 missense probably damaging 1.00
R3718:Neb UTSW 2 52277470 missense probably damaging 1.00
R3786:Neb UTSW 2 52201915 missense probably damaging 1.00
R3809:Neb UTSW 2 52256789 missense possibly damaging 0.73
R3840:Neb UTSW 2 52207660 critical splice donor site probably null
R3841:Neb UTSW 2 52207660 critical splice donor site probably null
R3956:Neb UTSW 2 52201963 missense possibly damaging 0.62
R3958:Neb UTSW 2 52263629 missense probably damaging 1.00
R4057:Neb UTSW 2 52206699 missense possibly damaging 0.89
R4057:Neb UTSW 2 52237108 missense probably benign 0.32
R4110:Neb UTSW 2 52148766 missense probably benign 0.10
R4110:Neb UTSW 2 52244125 missense probably damaging 1.00
R4128:Neb UTSW 2 52292700 missense probably damaging 1.00
R4195:Neb UTSW 2 52271559 missense probably damaging 1.00
R4195:Neb UTSW 2 52290835 missense probably damaging 1.00
R4288:Neb UTSW 2 52259300 missense probably damaging 1.00
R4323:Neb UTSW 2 52264110 missense possibly damaging 0.93
R4394:Neb UTSW 2 52187513 nonsense probably null
R4463:Neb UTSW 2 52279722 frame shift probably null
R4527:Neb UTSW 2 52193237 missense probably benign 0.42
R4561:Neb UTSW 2 52286155 missense probably damaging 1.00
R4612:Neb UTSW 2 52287243 missense probably damaging 0.99
R4621:Neb UTSW 2 52271039 nonsense probably null
R4628:Neb UTSW 2 52308350 nonsense probably null
R4655:Neb UTSW 2 52227299 missense probably damaging 0.98
R4660:Neb UTSW 2 52255588 missense possibly damaging 0.85
R4683:Neb UTSW 2 52244062 missense possibly damaging 0.89
R4687:Neb UTSW 2 52304035 missense possibly damaging 0.95
R4690:Neb UTSW 2 52244075 missense probably benign 0.25
R4710:Neb UTSW 2 52260598 missense probably benign 0.32
R4729:Neb UTSW 2 52263662 missense possibly damaging 0.80
R4732:Neb UTSW 2 52279079 missense probably damaging 1.00
R4733:Neb UTSW 2 52279079 missense probably damaging 1.00
R4738:Neb UTSW 2 52187482 missense probably damaging 1.00
R4744:Neb UTSW 2 52150577 missense probably benign 0.29
R4755:Neb UTSW 2 52220209 missense probably damaging 1.00
R4756:Neb UTSW 2 52193231 missense probably damaging 0.96
R4763:Neb UTSW 2 52237040 nonsense probably null
R4763:Neb UTSW 2 52326720 nonsense probably null
R4770:Neb UTSW 2 52149153 missense probably benign 0.00
R4802:Neb UTSW 2 52200703 missense possibly damaging 0.65
R4824:Neb UTSW 2 52204879 missense possibly damaging 0.86
R4830:Neb UTSW 2 52192520 missense probably damaging 0.99
R4855:Neb UTSW 2 52298894 missense probably damaging 1.00
R4857:Neb UTSW 2 52201980 missense probably damaging 1.00
R4878:Neb UTSW 2 52219394 missense probably damaging 1.00
R4885:Neb UTSW 2 52286046 missense probably damaging 1.00
R4888:Neb UTSW 2 52296307 missense probably benign 0.17
R4928:Neb UTSW 2 52212975 missense possibly damaging 0.79
R4954:Neb UTSW 2 52177518 splice site probably null
R4974:Neb UTSW 2 52246859 missense probably damaging 1.00
R4979:Neb UTSW 2 52189909 missense probably damaging 1.00
R4983:Neb UTSW 2 52216261 missense probably damaging 0.99
R4990:Neb UTSW 2 52255546 missense probably benign
R5026:Neb UTSW 2 52204880 missense possibly damaging 0.94
R5030:Neb UTSW 2 52334492 start gained probably benign
R5062:Neb UTSW 2 52280501 missense possibly damaging 0.94
R5063:Neb UTSW 2 52223212 start gained probably benign
R5099:Neb UTSW 2 52195448 missense probably damaging 1.00
R5102:Neb UTSW 2 52226570 missense possibly damaging 0.70
R5124:Neb UTSW 2 52281498 missense probably damaging 1.00
R5150:Neb UTSW 2 52169118 missense probably benign 0.09
R5217:Neb UTSW 2 52162130 nonsense probably null
R5280:Neb UTSW 2 52147156 missense probably damaging 1.00
R5288:Neb UTSW 2 52189861 missense probably damaging 0.99
R5314:Neb UTSW 2 52281503 missense probably benign 0.22
R5340:Neb UTSW 2 52223048 missense probably damaging 1.00
R5375:Neb UTSW 2 52212584 missense possibly damaging 0.75
R5385:Neb UTSW 2 52189861 missense probably damaging 0.99
R5411:Neb UTSW 2 52295372 missense probably damaging 0.98
R5470:Neb UTSW 2 52249438 missense possibly damaging 0.88
R5500:Neb UTSW 2 52162067 critical splice donor site probably null
R5523:Neb UTSW 2 52278815 missense probably benign
R5527:Neb UTSW 2 52334453 missense unknown
R5622:Neb UTSW 2 52270269 missense probably damaging 0.96
R5625:Neb UTSW 2 52177535 nonsense probably null
R5688:Neb UTSW 2 52196327 missense probably damaging 1.00
R5715:Neb UTSW 2 52251768 missense probably damaging 1.00
R5716:Neb UTSW 2 52210584 missense probably benign
R5760:Neb UTSW 2 52183818 missense probably damaging 1.00
R5779:Neb UTSW 2 52245301 missense probably damaging 0.99
R5782:Neb UTSW 2 52264047 nonsense probably null
R5862:Neb UTSW 2 52179542 nonsense probably null
R5905:Neb UTSW 2 52193231 missense probably damaging 0.99
R5918:Neb UTSW 2 52197894 missense probably damaging 1.00
R5939:Neb UTSW 2 52257594 missense probably benign
R5959:Neb UTSW 2 52156377 missense probably benign 0.22
R5976:Neb UTSW 2 52216916 missense possibly damaging 0.88
R5987:Neb UTSW 2 52295294 missense probably benign 0.10
R6020:Neb UTSW 2 52257827 missense probably benign 0.05
R6028:Neb UTSW 2 52193231 missense probably damaging 0.99
R6045:Neb UTSW 2 52194425 unclassified probably null
R6062:Neb UTSW 2 52185281 missense probably benign 0.05
R6088:Neb UTSW 2 52209342 missense probably damaging 1.00
R6093:Neb UTSW 2 52251770 nonsense probably null
R6119:Neb UTSW 2 52220931 missense probably benign 0.36
R6167:Neb UTSW 2 52147237 missense probably benign 0.12
R6192:Neb UTSW 2 52256790 missense probably benign 0.00
R6216:Neb UTSW 2 52224552 missense probably benign 0.45
R6220:Neb UTSW 2 52270972 missense probably null 0.00
R6239:Neb UTSW 2 52273988 missense probably benign
R6242:Neb UTSW 2 52176812 missense probably damaging 1.00
R6254:Neb UTSW 2 52222961 missense probably benign 0.01
R6262:Neb UTSW 2 52308687 missense probably damaging 0.98
R6305:Neb UTSW 2 52251763 nonsense probably null
R6319:Neb UTSW 2 52163011 critical splice acceptor site probably null
R6333:Neb UTSW 2 52258263 missense probably damaging 1.00
R6341:Neb UTSW 2 52209474 missense probably damaging 1.00
R6362:Neb UTSW 2 52212692 missense probably benign 0.01
R6378:Neb UTSW 2 52293721 missense probably damaging 1.00
R6385:Neb UTSW 2 52185299 missense probably damaging 0.99
R6404:Neb UTSW 2 52207725 missense probably damaging 0.99
R6416:Neb UTSW 2 52185328 missense probably benign 0.10
R6437:Neb UTSW 2 52257557 splice site probably null
R6448:Neb UTSW 2 52148814 missense probably damaging 1.00
R6450:Neb UTSW 2 52194469 nonsense probably null
R6452:Neb UTSW 2 52179483 missense probably benign 0.00
R6455:Neb UTSW 2 52167644 nonsense probably null
R6474:Neb UTSW 2 52280612 missense probably benign 0.00
R6497:Neb UTSW 2 52258289 missense possibly damaging 0.53
R6502:Neb UTSW 2 52291082 missense probably benign 0.34
R6572:Neb UTSW 2 52278847 missense probably damaging 1.00
R6617:Neb UTSW 2 52207747 missense probably damaging 1.00
R6659:Neb UTSW 2 52234353 missense probably damaging 1.00
R6667:Neb UTSW 2 52147189 missense probably damaging 1.00
R6701:Neb UTSW 2 52291208 missense probably damaging 1.00
R6711:Neb UTSW 2 52223064 missense probably benign 0.22
R6711:Neb UTSW 2 52256287 missense probably damaging 1.00
R6861:Neb UTSW 2 52195720 missense probably damaging 1.00
R6872:Neb UTSW 2 52293645 missense probably damaging 0.99
R6886:Neb UTSW 2 52220224 missense probably damaging 1.00
X0021:Neb UTSW 2 52270300 missense probably benign
X0026:Neb UTSW 2 52243904 missense probably benign 0.34
X0027:Neb UTSW 2 52227314 missense probably damaging 1.00
X0065:Neb UTSW 2 52249304 missense possibly damaging 0.95
Z1088:Neb UTSW 2 52169872 missense possibly damaging 0.68
Z1088:Neb UTSW 2 52223152 missense probably benign 0.00
Z1088:Neb UTSW 2 52308567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGCACTTTCTCGGGTAC -3'
(R):5'- AGGAGAGTAGCCATGACACC -3'

Sequencing Primer
(F):5'- GTACCAAGTCTAGTCCCCAGTTAGG -3'
(R):5'- GAGAGTAGCCATGACACCATCTG -3'
Posted OnFeb 04, 2016