Incidental Mutation 'R0421:Nop56'
ID37037
Institutional Source Beutler Lab
Gene Symbol Nop56
Ensembl Gene ENSMUSG00000027405
Gene NameNOP56 ribonucleoprotein
SynonymsNOP56, Nol5a, 2310044F10Rik, 56kDa with KKE/D repeat
MMRRC Submission 038623-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.972) question?
Stock #R0421 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location130274430-130279313 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130276772 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 275 (S275P)
Ref Sequence ENSEMBL: ENSMUSP00000099487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028890] [ENSMUST00000028892] [ENSMUST00000103198] [ENSMUST00000136621] [ENSMUST00000159373] [ENSMUST00000184538]
Predicted Effect probably benign
Transcript: ENSMUST00000028890
SMART Domains Protein: ENSMUSP00000028890
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Nop 44 127 1.1e-26 PFAM
coiled coil region 131 176 N/A INTRINSIC
low complexity region 185 204 N/A INTRINSIC
low complexity region 213 228 N/A INTRINSIC
low complexity region 242 264 N/A INTRINSIC
low complexity region 280 292 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000028892
SMART Domains Protein: ENSMUSP00000028892
Gene: ENSMUSG00000027406

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
Iso_dh 49 375 1.43e-140 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083355
Predicted Effect possibly damaging
Transcript: ENSMUST00000103198
AA Change: S275P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099487
Gene: ENSMUSG00000027405
AA Change: S275P

DomainStartEndE-ValueType
Pfam:NOP5NT 5 70 4.3e-20 PFAM
NOSIC 167 219 1.18e-30 SMART
internal_repeat_1 257 305 4.06e-5 PROSPERO
coiled coil region 415 460 N/A INTRINSIC
low complexity region 469 488 N/A INTRINSIC
low complexity region 497 512 N/A INTRINSIC
low complexity region 526 548 N/A INTRINSIC
low complexity region 564 576 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133351
Predicted Effect probably benign
Transcript: ENSMUST00000136621
SMART Domains Protein: ENSMUSP00000124616
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
Pfam:NOP5NT 4 70 3.6e-22 PFAM
NOSIC 167 219 1.18e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138163
Predicted Effect probably benign
Transcript: ENSMUST00000141872
SMART Domains Protein: ENSMUSP00000125305
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
Pfam:NOP5NT 14 79 3.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145335
Predicted Effect unknown
Transcript: ENSMUST00000146454
AA Change: S19P
SMART Domains Protein: ENSMUSP00000125304
Gene: ENSMUSG00000027405
AA Change: S19P

DomainStartEndE-ValueType
Pfam:Nop 1 152 7.8e-66 PFAM
coiled coil region 159 204 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000149955
AA Change: S90P
SMART Domains Protein: ENSMUSP00000123879
Gene: ENSMUSG00000027405
AA Change: S90P

DomainStartEndE-ValueType
NOSIC 2 35 1.24e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150401
SMART Domains Protein: ENSMUSP00000123890
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
Pfam:Nop 26 103 3.9e-26 PFAM
coiled coil region 110 155 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153353
Predicted Effect probably benign
Transcript: ENSMUST00000159373
SMART Domains Protein: ENSMUSP00000124080
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
Pfam:Nop 10 94 6e-28 PFAM
coiled coil region 98 135 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160976
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161025
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161543
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162063
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175746
Predicted Effect probably benign
Transcript: ENSMUST00000184538
SMART Domains Protein: ENSMUSP00000139331
Gene: ENSMUSG00000027406

DomainStartEndE-ValueType
Pfam:Iso_dh 6 71 1.8e-15 PFAM
Meta Mutation Damage Score 0.254 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nop56p is a yeast nucleolar protein that is part of a complex with the nucleolar proteins Nop58p and fibrillarin. Nop56p is required for assembly of the 60S ribosomal subunit and is involved in pre-rRNA processing. The protein encoded by this gene is similar in sequence to Nop56p and is also found in the nucleolus. Expansion of a GGCCTG repeat from 3-8 copies to 1500-2500 copies in an intron of this gene results in spinocerebellar ataxia 36. Multiple transcript variants encoding several different isoforms have been found for this gene, but the full-length nature of most of them has not been determined. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik T C 3: 92,868,984 T131A probably damaging Het
Abi1 G A 2: 22,960,827 T195I probably damaging Het
Afap1l1 T C 18: 61,751,874 N180S probably damaging Het
Arsg A G 11: 109,527,766 Y196C probably damaging Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
Atp2b2 C A 6: 113,813,888 R185L probably damaging Het
Ccr9 A T 9: 123,779,606 M118L probably benign Het
Cdh12 A T 15: 21,480,224 probably null Het
Cdk13 T C 13: 17,763,170 S763G probably damaging Het
Cenpk C A 13: 104,242,403 N177K probably benign Het
Cfap43 T G 19: 47,835,575 N119T probably benign Het
Chrna6 T C 8: 27,408,387 E101G probably null Het
Clasp2 G A 9: 113,854,302 R400H probably benign Het
Col6a6 T C 9: 105,784,206 M235V probably benign Het
Ddx49 A T 8: 70,295,632 L291Q probably damaging Het
Dhrs7 A T 12: 72,653,086 probably benign Het
Dnah5 A T 15: 28,229,541 K107M possibly damaging Het
Dsg2 C T 18: 20,579,391 R151C probably damaging Het
Dsn1 T C 2: 157,005,869 T2A possibly damaging Het
Edem3 A G 1: 151,792,438 probably benign Het
Eif3c T C 7: 126,563,712 N133S possibly damaging Het
F10 A G 8: 13,045,097 K85E probably benign Het
Fam129a T A 1: 151,709,082 probably benign Het
Fam57b G A 7: 126,825,015 V44M probably damaging Het
Fbn2 T A 18: 58,027,804 probably benign Het
Gtpbp10 A T 5: 5,557,290 H50Q probably benign Het
Hephl1 A G 9: 15,059,160 F1013L probably benign Het
Hps3 C A 3: 20,029,316 V238F probably benign Het
Kcna10 A C 3: 107,194,504 K150N probably damaging Het
Kirrel C T 3: 87,083,607 G636D probably damaging Het
Kndc1 G A 7: 139,908,996 R189H probably damaging Het
Knop1 C T 7: 118,855,629 E50K possibly damaging Het
Kpna7 T A 5: 144,989,741 H467L possibly damaging Het
Lcn4 T C 2: 26,668,649 N142D possibly damaging Het
Map3k3 T C 11: 106,148,915 probably benign Het
Mdn1 A G 4: 32,684,707 T806A probably benign Het
Nbeal1 T A 1: 60,268,439 N1703K probably benign Het
Neurl4 T C 11: 69,908,534 V914A probably damaging Het
Olfr352 A G 2: 36,869,641 E25G possibly damaging Het
Olfr655 A G 7: 104,596,722 V153A probably benign Het
Olfr868 A G 9: 20,101,475 K239E probably damaging Het
Otof A C 5: 30,371,568 I1827S possibly damaging Het
Pappa2 A T 1: 158,848,080 I1032N probably damaging Het
Pcdh7 A G 5: 57,720,060 E319G probably damaging Het
Pcdhb11 T A 18: 37,422,480 S288T probably benign Het
Phip A T 9: 82,926,457 D488E probably damaging Het
Pla2g7 A T 17: 43,611,412 H394L probably damaging Het
Plk3 A G 4: 117,133,444 V69A probably damaging Het
Prob1 C A 18: 35,653,030 A724S possibly damaging Het
Prune2 T C 19: 17,123,311 F2060L probably benign Het
Rgl3 G A 9: 21,976,032 R498C probably benign Het
Rnf213 A C 11: 119,447,257 N3362H probably damaging Het
Sbds A G 5: 130,253,933 probably benign Het
Scn9a T C 2: 66,543,277 S453G probably benign Het
Sh3rf3 T C 10: 58,984,075 L236P probably damaging Het
Skint1 A G 4: 112,019,014 N44S possibly damaging Het
Slc5a1 T A 5: 33,134,652 I141N probably damaging Het
Trank1 T A 9: 111,391,839 I2548N probably damaging Het
Tsc22d2 G A 3: 58,417,328 probably benign Het
Unc13c T A 9: 73,933,210 I120F possibly damaging Het
Vmn2r11 T G 5: 109,059,428 I9L probably benign Het
Vmn2r58 T G 7: 41,865,204 N114H probably benign Het
Vps53 A G 11: 76,082,670 L166P probably damaging Het
Zfp119a T A 17: 55,865,248 K532* probably null Het
Zfp472 A G 17: 32,975,923 T11A possibly damaging Het
Zfp512b T A 2: 181,588,258 K87* probably null Het
Zfp518b G A 5: 38,674,575 P29L probably damaging Het
Zfp599 A G 9: 22,250,547 probably benign Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Nop56
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Nop56 APN 2 130275995 missense possibly damaging 0.77
IGL02330:Nop56 APN 2 130276766 missense probably damaging 0.99
IGL02939:Nop56 APN 2 130278197 missense probably damaging 1.00
IGL03149:Nop56 APN 2 130277525 missense probably damaging 1.00
IGL03046:Nop56 UTSW 2 130275569 unclassified probably benign
R1405:Nop56 UTSW 2 130277948 missense probably benign 0.22
R1405:Nop56 UTSW 2 130277948 missense probably benign 0.22
R1713:Nop56 UTSW 2 130277966 missense possibly damaging 0.85
R2202:Nop56 UTSW 2 130277568 missense probably damaging 1.00
R2203:Nop56 UTSW 2 130277568 missense probably damaging 1.00
R2204:Nop56 UTSW 2 130277568 missense probably damaging 1.00
R3697:Nop56 UTSW 2 130277587 missense probably damaging 1.00
R4114:Nop56 UTSW 2 130276673 unclassified probably null
R4679:Nop56 UTSW 2 130278273 missense probably benign 0.36
R4788:Nop56 UTSW 2 130278900 missense probably benign 0.05
R4792:Nop56 UTSW 2 130277864 missense possibly damaging 0.96
R4999:Nop56 UTSW 2 130275725 missense probably benign 0.00
R5889:Nop56 UTSW 2 130275982 missense probably damaging 1.00
R6016:Nop56 UTSW 2 130276625 critical splice donor site probably null
R6389:Nop56 UTSW 2 130277887 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCCATCTTGGATGCTTCTCG -3'
(R):5'- CTGTACTGTGGACGCTGGATACTTG -3'

Sequencing Primer
(F):5'- GGATGCTTCTCGGTCCTC -3'
(R):5'- GTAAGTGGGAACCTGACCTC -3'
Posted On2013-05-09