Incidental Mutation 'R4801:Eif2ak3'
ID370385
Institutional Source Beutler Lab
Gene Symbol Eif2ak3
Ensembl Gene ENSMUSG00000031668
Gene Nameeukaryotic translation initiation factor 2 alpha kinase 3
SynonymsPERK
MMRRC Submission 042423-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.571) question?
Stock #R4801 (G1)
Quality Score149
Status Validated
Chromosome6
Chromosomal Location70844515-70905245 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70887893 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 578 (Y578H)
Ref Sequence ENSEMBL: ENSMUSP00000034093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034093]
Predicted Effect probably benign
Transcript: ENSMUST00000034093
AA Change: Y578H

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000034093
Gene: ENSMUSG00000031668
AA Change: Y578H

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 48 82 N/A INTRINSIC
low complexity region 125 139 N/A INTRINSIC
low complexity region 221 230 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
Pfam:Pkinase_Tyr 589 662 1.6e-6 PFAM
Pfam:Pkinase 589 673 3.2e-12 PFAM
Pfam:Pkinase 839 1075 1.9e-38 PFAM
Pfam:Pkinase_Tyr 859 1073 5.8e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159401
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199580
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: The protein encoded by this gene phosphorylates the alpha subunit of eukaryotic translation-initiation factor 2, leading to its inactivation, and thus to a rapid reduction of translational initiation and repression of global protein synthesis. This protein is thought to modulate mitochondrial function. It is a type I membrane protein located in the endoplasmic reticulum (ER), where it is induced by ER stress caused by malfolded proteins. Mutations in a similar gene in human are associated with Wolcott-Rallison syndrome. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutant mice develop exocrine pancreatic insufficiency and progressive diabetes mellitus. They are growth retarded, hyperglycemic, exhibit increased cell death in the pancreas, have decreased numbers of pancreatic beta cells and about half diebefore weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 164 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A G 10: 28,983,926 probably null Het
Aadacl3 A G 4: 144,456,232 I222T probably damaging Het
Abca13 G T 11: 9,522,341 G4249V possibly damaging Het
Abcb10 A G 8: 123,966,527 V346A probably benign Het
Abcc2 A T 19: 43,819,361 I814F probably damaging Het
AF366264 T A 8: 13,836,970 I374F possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd28 A C 14: 31,736,830 D335E probably damaging Het
Ankrd44 T C 1: 54,762,316 H284R probably damaging Het
Arfgef3 G T 10: 18,591,906 Q1849K probably benign Het
Atp2c2 T C 8: 119,747,687 M490T probably damaging Het
Bach1 T A 16: 87,722,452 D543E probably damaging Het
Bahcc1 G A 11: 120,282,225 V1558I probably benign Het
Bbs5 T A 2: 69,655,614 W168R probably damaging Het
Bcar3 A T 3: 122,529,594 D766V probably benign Het
C1ra A G 6: 124,513,768 D40G probably benign Het
Ccdc138 G A 10: 58,573,643 C598Y probably damaging Het
Cd200r3 T A 16: 44,957,825 N197K possibly damaging Het
Cenpf T A 1: 189,651,220 E2634D probably damaging Het
Cisd2 T C 3: 135,411,141 K63R probably damaging Het
Clca3a2 A T 3: 144,807,351 S478T possibly damaging Het
Clptm1l T C 13: 73,607,862 M199T possibly damaging Het
Cntnap4 T A 8: 112,773,590 S505T possibly damaging Het
Cr2 C T 1: 195,163,311 G112D probably damaging Het
Crb2 T A 2: 37,793,756 I1090N probably benign Het
Csmd3 G T 15: 47,621,292 P3057Q probably damaging Het
Ctso G A 3: 81,954,240 V307I probably damaging Het
Cyp3a41b T A 5: 145,573,651 T138S probably benign Het
Dctn3 G T 4: 41,719,904 Y67* probably null Het
Dennd4c C A 4: 86,819,884 Y918* probably null Het
Dlg5 C T 14: 24,154,689 G1262D probably damaging Het
Dnaaf1 G A 8: 119,577,361 G46D probably benign Het
Dnah6 A G 6: 73,089,698 V2563A probably damaging Het
Dnajc13 A G 9: 104,175,727 Y1679H probably benign Het
Endod1 C T 9: 14,357,023 V389M probably benign Het
Ephb4 T C 5: 137,365,506 L582P probably damaging Het
Eps15 T C 4: 109,324,217 L316S possibly damaging Het
Erbb4 G T 1: 68,330,246 T412K probably damaging Het
Fam117a T A 11: 95,364,070 F90I probably damaging Het
Fam187b T G 7: 30,977,090 V8G possibly damaging Het
Fam84b C A 15: 60,823,944 probably benign Het
Far1 T A 7: 113,539,453 I59N possibly damaging Het
Fbxo34 T A 14: 47,530,869 L562Q probably damaging Het
Frem1 T A 4: 82,916,628 probably benign Het
Gfra3 G T 18: 34,720,192 P10Q probably damaging Het
Gm10698 A G 9: 33,728,772 noncoding transcript Het
Gm11487 C T 4: 73,401,267 W80* probably null Het
Gm19965 T A 1: 116,821,896 Y436N probably benign Het
Gm21818 T A 13: 120,173,222 S13R probably benign Het
Gm5767 A G 16: 8,683,345 T22A unknown Het
Gm5799 A T 14: 43,544,548 H59L probably damaging Het
Gmppb T A 9: 108,050,217 V121E probably benign Het
Ighv7-4 G C 12: 114,223,279 probably benign Het
Ipo4 A G 14: 55,631,214 S446P probably damaging Het
Itpr2 T C 6: 146,371,331 T855A probably damaging Het
Jaml T C 9: 45,101,064 I283T possibly damaging Het
Kcnn2 T C 18: 45,685,267 probably benign Het
Klhl32 T C 4: 24,649,698 Y399C possibly damaging Het
Lrriq1 G A 10: 103,221,318 T207I probably benign Het
Lrriq3 A T 3: 155,187,970 H436L probably benign Het
Mad2l1bp T C 17: 46,148,263 K114E possibly damaging Het
Mamstr T C 7: 45,642,418 V64A possibly damaging Het
Map4 T A 9: 110,035,257 S517T probably benign Het
Matn1 A T 4: 130,950,025 I182F possibly damaging Het
Mcm3 A G 1: 20,810,156 I484T probably damaging Het
Med13 T A 11: 86,278,773 I1922F probably damaging Het
Metap2 A G 10: 93,868,895 V137A probably damaging Het
Mex3d A G 10: 80,386,954 V156A possibly damaging Het
Mfsd6 G A 1: 52,709,596 P37S probably benign Het
Mkl1 T C 15: 81,104,799 E7G probably benign Het
Mrgprx1 A C 7: 48,021,211 S263A possibly damaging Het
Msl1 C T 11: 98,803,969 R505* probably null Het
Mta2 T C 19: 8,945,851 S96P probably damaging Het
Mtr A T 13: 12,195,251 N986K probably benign Het
Mut A G 17: 40,937,351 T90A probably benign Het
Mutyh C T 4: 116,817,029 T259I probably benign Het
Myof T C 19: 37,945,738 T908A probably benign Het
Nav2 A T 7: 49,545,852 D992V possibly damaging Het
Neb T C 2: 52,200,703 T1352A possibly damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nudt6 G A 3: 37,405,354 R161C probably benign Het
Olfr1122 T A 2: 87,388,209 V168E probably benign Het
Olfr1173 T A 2: 88,274,879 M57L probably damaging Het
Olfr125 T C 17: 37,835,349 Y117H probably damaging Het
Olfr1276 T A 2: 111,257,152 F12L probably damaging Het
Olfr1411 T A 1: 92,596,998 C160S probably benign Het
Olfr154 T A 2: 85,664,278 D52V probably damaging Het
Olfr23 T A 11: 73,940,870 I208K possibly damaging Het
Olfr319 T C 11: 58,701,791 V30A probably benign Het
Olfr456 A T 6: 42,486,679 N171K probably benign Het
Olfr744 A G 14: 50,619,022 T267A probably benign Het
Olfr959 T G 9: 39,572,858 M134L probably benign Het
Olr1 A G 6: 129,488,090 F141S possibly damaging Het
Oprl1 G T 2: 181,719,253 M340I probably benign Het
Otogl A C 10: 107,901,336 C72W probably damaging Het
Pcdha11 T A 18: 37,005,465 I49N probably damaging Het
Pcdha4 T A 18: 36,953,955 L397* probably null Het
Pcdhb14 A G 18: 37,448,278 S146G probably benign Het
Pclo T A 5: 14,675,815 H1562Q unknown Het
Pcsk9 T C 4: 106,447,569 E434G probably benign Het
Phc2 A G 4: 128,751,598 K833E probably damaging Het
Pja2 A T 17: 64,292,862 S480R probably damaging Het
Pkd1 G A 17: 24,578,096 G2493D probably damaging Het
Plk5 G A 10: 80,359,304 V179M possibly damaging Het
Polr1a G A 6: 71,976,070 V1541I probably benign Het
Ppard C G 17: 28,286,374 R12G unknown Het
Ppp1r14a A G 7: 29,291,526 D73G probably damaging Het
Psd3 C T 8: 68,121,148 R127H probably benign Het
Pten G T 19: 32,758,503 G20V possibly damaging Het
Ptprg T C 14: 11,554,233 probably benign Het
Rad54l T C 4: 116,122,924 D21G probably null Het
Rgs14 T C 13: 55,380,957 Y304H probably damaging Het
Rgs9 T C 11: 109,240,868 K346R probably damaging Het
Rnf169 C G 7: 99,926,446 G314A probably damaging Het
Rpgrip1l T A 8: 91,270,177 T692S probably damaging Het
Rtf1 T C 2: 119,675,228 V54A possibly damaging Het
Rtn4 T C 11: 29,708,660 V938A probably benign Het
Ryr2 T A 13: 11,687,932 D2890V probably damaging Het
Ryr2 T C 13: 11,708,227 T2509A probably damaging Het
Scel A C 14: 103,583,100 T348P probably benign Het
Scgb1b2 G T 7: 31,291,573 L37I possibly damaging Het
Sdf4 A G 4: 156,000,721 H171R possibly damaging Het
Sec31a A G 5: 100,393,363 V295A probably damaging Het
Setx T A 2: 29,146,373 S957T probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Six5 A G 7: 19,096,969 N507S probably benign Het
Slc12a7 T C 13: 73,763,892 probably null Het
Slc1a7 T A 4: 107,993,040 V116E probably damaging Het
Slc22a1 A G 17: 12,675,535 L42P probably damaging Het
Slc25a31 A T 3: 40,721,545 I174F probably damaging Het
Slc31a2 A T 4: 62,292,632 M3L probably damaging Het
Slco1a4 T A 6: 141,845,497 probably benign Het
Smcr8 C T 11: 60,778,610 probably null Het
Smg5 G T 3: 88,355,692 E801* probably null Het
Smgc C A 15: 91,854,616 H492Q probably benign Het
Smyd4 G T 11: 75,403,184 G694V probably damaging Het
Sorcs3 A G 19: 48,398,744 T223A possibly damaging Het
Stab1 G T 14: 31,141,371 C2119* probably null Het
Taar9 A G 10: 24,108,843 I231T probably damaging Het
Tacr2 A G 10: 62,261,548 Y269C probably damaging Het
Taf3 T G 2: 9,951,123 K744N possibly damaging Het
Tenm4 T A 7: 96,906,245 V2682E probably damaging Het
Tet1 A C 10: 62,822,663 L1468R probably damaging Het
Tgds T C 14: 118,117,033 probably benign Het
Tgfb2 A T 1: 186,628,913 Y380* probably null Het
Tgm5 T G 2: 121,052,472 K435Q probably damaging Het
Themis A G 10: 28,761,511 T204A probably benign Het
Tm4sf1 T C 3: 57,294,679 Y37C probably damaging Het
Tnn T C 1: 160,145,033 N333S possibly damaging Het
Tppp2 A G 14: 51,919,348 N61D probably benign Het
Treml2 A G 17: 48,309,159 T276A probably benign Het
Trit1 T C 4: 123,016,638 V10A probably benign Het
Uba1y T G Y: 825,890 probably null Het
Uqcc1 T C 2: 155,858,106 probably benign Het
Vcam1 C G 3: 116,115,935 G581A probably damaging Het
Vmn1r16 G A 6: 57,323,190 T149I probably benign Het
Vmn1r209 T C 13: 22,805,656 D288G probably damaging Het
Vmn1r78 T A 7: 12,152,964 Y167* probably null Het
Vmn2r103 T A 17: 19,795,076 S493T probably benign Het
Vmn2r105 T A 17: 20,227,294 M423L probably benign Het
Vps13c T C 9: 67,964,282 F3244L probably damaging Het
Zfp119b A T 17: 55,939,642 D149E probably damaging Het
Zfp345 T C 2: 150,473,308 Y103C possibly damaging Het
Zmym6 C T 4: 127,123,216 T930I probably benign Het
Other mutations in Eif2ak3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Eif2ak3 APN 6 70892726 missense probably damaging 1.00
IGL02069:Eif2ak3 APN 6 70896965 missense probably damaging 1.00
IGL02197:Eif2ak3 APN 6 70901457 missense probably benign 0.37
IGL03150:Eif2ak3 APN 6 70892436 missense possibly damaging 0.68
R0024:Eif2ak3 UTSW 6 70892356 missense probably benign 0.01
R0130:Eif2ak3 UTSW 6 70881732 splice site probably benign
R0394:Eif2ak3 UTSW 6 70885218 missense probably benign 0.03
R0699:Eif2ak3 UTSW 6 70892530 missense probably benign 0.16
R1648:Eif2ak3 UTSW 6 70883631 missense possibly damaging 0.52
R1708:Eif2ak3 UTSW 6 70887806 missense probably damaging 0.99
R1953:Eif2ak3 UTSW 6 70892554 missense probably benign 0.03
R2062:Eif2ak3 UTSW 6 70904197 missense probably benign 0.02
R2875:Eif2ak3 UTSW 6 70883639 missense probably damaging 1.00
R4260:Eif2ak3 UTSW 6 70889513 missense probably damaging 0.98
R4357:Eif2ak3 UTSW 6 70884875 missense probably damaging 0.98
R4786:Eif2ak3 UTSW 6 70892618 missense possibly damaging 0.95
R4802:Eif2ak3 UTSW 6 70887893 missense probably benign 0.01
R5194:Eif2ak3 UTSW 6 70858478 missense possibly damaging 0.83
R5260:Eif2ak3 UTSW 6 70893129 missense probably damaging 1.00
R5710:Eif2ak3 UTSW 6 70883733 missense probably damaging 1.00
R5724:Eif2ak3 UTSW 6 70876840 missense probably benign 0.19
R6089:Eif2ak3 UTSW 6 70896934 missense possibly damaging 0.87
R6656:Eif2ak3 UTSW 6 70883715 missense probably damaging 1.00
R6940:Eif2ak3 UTSW 6 70892402 missense possibly damaging 0.82
R6949:Eif2ak3 UTSW 6 70878845 missense probably damaging 0.99
R6958:Eif2ak3 UTSW 6 70892683 missense probably benign 0.01
R7168:Eif2ak3 UTSW 6 70881626 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGTGCCATTTGCTGTTCAGTG -3'
(R):5'- GCCCTCAATAGTTCAAGGGC -3'

Sequencing Primer
(F):5'- CAGTGTTATCTCTTGAGATGAGATG -3'
(R):5'- CTGTCCAATCTTCTAAGAGGAGCG -3'
Posted On2016-02-04