Incidental Mutation 'R4801:Itpr2'
ID370386
Institutional Source Beutler Lab
Gene Symbol Itpr2
Ensembl Gene ENSMUSG00000030287
Gene Nameinositol 1,4,5-triphosphate receptor 2
SynonymsItpr5, Ip3r2
MMRRC Submission 042423-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4801 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location146108299-146502223 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 146371331 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 855 (T855A)
Ref Sequence ENSEMBL: ENSMUSP00000078526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053273] [ENSMUST00000079573] [ENSMUST00000131890] [ENSMUST00000139732]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053273
AA Change: T888A

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000049584
Gene: ENSMUSG00000030287
AA Change: T888A

DomainStartEndE-ValueType
low complexity region 68 80 N/A INTRINSIC
MIR 112 166 1.1e-5 SMART
MIR 173 223 8.9e-6 SMART
MIR 231 287 5.11e-6 SMART
MIR 294 402 3.73e-8 SMART
Pfam:RYDR_ITPR 473 670 1.5e-62 PFAM
low complexity region 882 890 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1346 1.6e-16 PFAM
low complexity region 1773 1785 N/A INTRINSIC
low complexity region 1897 1908 N/A INTRINSIC
Pfam:RIH_assoc 1912 2022 4.6e-34 PFAM
low complexity region 2088 2098 N/A INTRINSIC
transmembrane domain 2228 2250 N/A INTRINSIC
Pfam:Ion_trans 2260 2552 5.1e-20 PFAM
coiled coil region 2631 2686 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079573
AA Change: T855A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000078526
Gene: ENSMUSG00000030287
AA Change: T855A

DomainStartEndE-ValueType
low complexity region 68 80 N/A INTRINSIC
MIR 112 166 1.1e-5 SMART
MIR 198 254 5.11e-6 SMART
MIR 261 369 3.73e-8 SMART
Pfam:RYDR_ITPR 438 644 5.4e-75 PFAM
low complexity region 849 857 N/A INTRINSIC
Pfam:RYDR_ITPR 1148 1322 7.2e-60 PFAM
low complexity region 1740 1752 N/A INTRINSIC
Pfam:RIH_assoc 1875 1994 5.8e-35 PFAM
low complexity region 2055 2065 N/A INTRINSIC
transmembrane domain 2195 2217 N/A INTRINSIC
transmembrane domain 2230 2249 N/A INTRINSIC
low complexity region 2268 2279 N/A INTRINSIC
Pfam:Ion_trans 2281 2507 2.4e-12 PFAM
coiled coil region 2598 2653 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000131890
AA Change: T530A

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121773
Gene: ENSMUSG00000030287
AA Change: T530A

DomainStartEndE-ValueType
Pfam:MIR 1 74 4.8e-22 PFAM
Pfam:RYDR_ITPR 113 319 1.9e-76 PFAM
low complexity region 524 532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139732
SMART Domains Protein: ENSMUSP00000119110
Gene: ENSMUSG00000030287

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
MIR 65 119 1.1e-5 SMART
MIR 126 176 8.9e-6 SMART
MIR 184 240 5.11e-6 SMART
MIR 247 355 3.73e-8 SMART
Pfam:RYDR_ITPR 424 630 3e-76 PFAM
Meta Mutation Damage Score 0.18 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the inositol 1,4,5-triphosphate receptor family, whose members are second messenger intracellular calcium release channels. These proteins mediate a rise in cytoplasmic calcium in response to receptor activated production of inositol triphosphate. Inositol triphosphate receptor-mediated signaling is involved in many processes including cell migration, cell division, smooth muscle contraction, and neuronal signaling. This protein is a type 2 receptor that consists of a cytoplasmic amino-terminus that binds inositol triphosphate, six membrane-spanning helices that contribute to the ion pore, and a short cytoplasmic carboxy-terminus. A mutation in this gene has been associated with anhidrosis, suggesting that intracellular calcium release mediated by this protein is required for eccrine sweat production. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for a knock-out allele are viable and fertile but show decreased sweating and disturbed calcium signaling in sweat glands. Mice homozygous for a different knock-out allele have atrial myocytes that are significantly less prone to develop proarrhythmic disturbances in calcium signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 164 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A G 10: 28,983,926 probably null Het
Aadacl3 A G 4: 144,456,232 I222T probably damaging Het
Abca13 G T 11: 9,522,341 G4249V possibly damaging Het
Abcb10 A G 8: 123,966,527 V346A probably benign Het
Abcc2 A T 19: 43,819,361 I814F probably damaging Het
AF366264 T A 8: 13,836,970 I374F possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd28 A C 14: 31,736,830 D335E probably damaging Het
Ankrd44 T C 1: 54,762,316 H284R probably damaging Het
Arfgef3 G T 10: 18,591,906 Q1849K probably benign Het
Atp2c2 T C 8: 119,747,687 M490T probably damaging Het
Bach1 T A 16: 87,722,452 D543E probably damaging Het
Bahcc1 G A 11: 120,282,225 V1558I probably benign Het
Bbs5 T A 2: 69,655,614 W168R probably damaging Het
Bcar3 A T 3: 122,529,594 D766V probably benign Het
C1ra A G 6: 124,513,768 D40G probably benign Het
Ccdc138 G A 10: 58,573,643 C598Y probably damaging Het
Cd200r3 T A 16: 44,957,825 N197K possibly damaging Het
Cenpf T A 1: 189,651,220 E2634D probably damaging Het
Cisd2 T C 3: 135,411,141 K63R probably damaging Het
Clca3a2 A T 3: 144,807,351 S478T possibly damaging Het
Clptm1l T C 13: 73,607,862 M199T possibly damaging Het
Cntnap4 T A 8: 112,773,590 S505T possibly damaging Het
Cr2 C T 1: 195,163,311 G112D probably damaging Het
Crb2 T A 2: 37,793,756 I1090N probably benign Het
Csmd3 G T 15: 47,621,292 P3057Q probably damaging Het
Ctso G A 3: 81,954,240 V307I probably damaging Het
Cyp3a41b T A 5: 145,573,651 T138S probably benign Het
Dctn3 G T 4: 41,719,904 Y67* probably null Het
Dennd4c C A 4: 86,819,884 Y918* probably null Het
Dlg5 C T 14: 24,154,689 G1262D probably damaging Het
Dnaaf1 G A 8: 119,577,361 G46D probably benign Het
Dnah6 A G 6: 73,089,698 V2563A probably damaging Het
Dnajc13 A G 9: 104,175,727 Y1679H probably benign Het
Eif2ak3 T C 6: 70,887,893 Y578H probably benign Het
Endod1 C T 9: 14,357,023 V389M probably benign Het
Ephb4 T C 5: 137,365,506 L582P probably damaging Het
Eps15 T C 4: 109,324,217 L316S possibly damaging Het
Erbb4 G T 1: 68,330,246 T412K probably damaging Het
Fam117a T A 11: 95,364,070 F90I probably damaging Het
Fam187b T G 7: 30,977,090 V8G possibly damaging Het
Fam84b C A 15: 60,823,944 probably benign Het
Far1 T A 7: 113,539,453 I59N possibly damaging Het
Fbxo34 T A 14: 47,530,869 L562Q probably damaging Het
Frem1 T A 4: 82,916,628 probably benign Het
Gfra3 G T 18: 34,720,192 P10Q probably damaging Het
Gm10698 A G 9: 33,728,772 noncoding transcript Het
Gm11487 C T 4: 73,401,267 W80* probably null Het
Gm19965 T A 1: 116,821,896 Y436N probably benign Het
Gm21818 T A 13: 120,173,222 S13R probably benign Het
Gm5767 A G 16: 8,683,345 T22A unknown Het
Gm5799 A T 14: 43,544,548 H59L probably damaging Het
Gmppb T A 9: 108,050,217 V121E probably benign Het
Ighv7-4 G C 12: 114,223,279 probably benign Het
Ipo4 A G 14: 55,631,214 S446P probably damaging Het
Jaml T C 9: 45,101,064 I283T possibly damaging Het
Kcnn2 T C 18: 45,685,267 probably benign Het
Klhl32 T C 4: 24,649,698 Y399C possibly damaging Het
Lrriq1 G A 10: 103,221,318 T207I probably benign Het
Lrriq3 A T 3: 155,187,970 H436L probably benign Het
Mad2l1bp T C 17: 46,148,263 K114E possibly damaging Het
Mamstr T C 7: 45,642,418 V64A possibly damaging Het
Map4 T A 9: 110,035,257 S517T probably benign Het
Matn1 A T 4: 130,950,025 I182F possibly damaging Het
Mcm3 A G 1: 20,810,156 I484T probably damaging Het
Med13 T A 11: 86,278,773 I1922F probably damaging Het
Metap2 A G 10: 93,868,895 V137A probably damaging Het
Mex3d A G 10: 80,386,954 V156A possibly damaging Het
Mfsd6 G A 1: 52,709,596 P37S probably benign Het
Mkl1 T C 15: 81,104,799 E7G probably benign Het
Mrgprx1 A C 7: 48,021,211 S263A possibly damaging Het
Msl1 C T 11: 98,803,969 R505* probably null Het
Mta2 T C 19: 8,945,851 S96P probably damaging Het
Mtr A T 13: 12,195,251 N986K probably benign Het
Mut A G 17: 40,937,351 T90A probably benign Het
Mutyh C T 4: 116,817,029 T259I probably benign Het
Myof T C 19: 37,945,738 T908A probably benign Het
Nav2 A T 7: 49,545,852 D992V possibly damaging Het
Neb T C 2: 52,200,703 T1352A possibly damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nudt6 G A 3: 37,405,354 R161C probably benign Het
Olfr1122 T A 2: 87,388,209 V168E probably benign Het
Olfr1173 T A 2: 88,274,879 M57L probably damaging Het
Olfr125 T C 17: 37,835,349 Y117H probably damaging Het
Olfr1276 T A 2: 111,257,152 F12L probably damaging Het
Olfr1411 T A 1: 92,596,998 C160S probably benign Het
Olfr154 T A 2: 85,664,278 D52V probably damaging Het
Olfr23 T A 11: 73,940,870 I208K possibly damaging Het
Olfr319 T C 11: 58,701,791 V30A probably benign Het
Olfr456 A T 6: 42,486,679 N171K probably benign Het
Olfr744 A G 14: 50,619,022 T267A probably benign Het
Olfr959 T G 9: 39,572,858 M134L probably benign Het
Olr1 A G 6: 129,488,090 F141S possibly damaging Het
Oprl1 G T 2: 181,719,253 M340I probably benign Het
Otogl A C 10: 107,901,336 C72W probably damaging Het
Pcdha11 T A 18: 37,005,465 I49N probably damaging Het
Pcdha4 T A 18: 36,953,955 L397* probably null Het
Pcdhb14 A G 18: 37,448,278 S146G probably benign Het
Pclo T A 5: 14,675,815 H1562Q unknown Het
Pcsk9 T C 4: 106,447,569 E434G probably benign Het
Phc2 A G 4: 128,751,598 K833E probably damaging Het
Pja2 A T 17: 64,292,862 S480R probably damaging Het
Pkd1 G A 17: 24,578,096 G2493D probably damaging Het
Plk5 G A 10: 80,359,304 V179M possibly damaging Het
Polr1a G A 6: 71,976,070 V1541I probably benign Het
Ppard C G 17: 28,286,374 R12G unknown Het
Ppp1r14a A G 7: 29,291,526 D73G probably damaging Het
Psd3 C T 8: 68,121,148 R127H probably benign Het
Pten G T 19: 32,758,503 G20V possibly damaging Het
Ptprg T C 14: 11,554,233 probably benign Het
Rad54l T C 4: 116,122,924 D21G probably null Het
Rgs14 T C 13: 55,380,957 Y304H probably damaging Het
Rgs9 T C 11: 109,240,868 K346R probably damaging Het
Rnf169 C G 7: 99,926,446 G314A probably damaging Het
Rpgrip1l T A 8: 91,270,177 T692S probably damaging Het
Rtf1 T C 2: 119,675,228 V54A possibly damaging Het
Rtn4 T C 11: 29,708,660 V938A probably benign Het
Ryr2 T A 13: 11,687,932 D2890V probably damaging Het
Ryr2 T C 13: 11,708,227 T2509A probably damaging Het
Scel A C 14: 103,583,100 T348P probably benign Het
Scgb1b2 G T 7: 31,291,573 L37I possibly damaging Het
Sdf4 A G 4: 156,000,721 H171R possibly damaging Het
Sec31a A G 5: 100,393,363 V295A probably damaging Het
Setx T A 2: 29,146,373 S957T probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Six5 A G 7: 19,096,969 N507S probably benign Het
Slc12a7 T C 13: 73,763,892 probably null Het
Slc1a7 T A 4: 107,993,040 V116E probably damaging Het
Slc22a1 A G 17: 12,675,535 L42P probably damaging Het
Slc25a31 A T 3: 40,721,545 I174F probably damaging Het
Slc31a2 A T 4: 62,292,632 M3L probably damaging Het
Slco1a4 T A 6: 141,845,497 probably benign Het
Smcr8 C T 11: 60,778,610 probably null Het
Smg5 G T 3: 88,355,692 E801* probably null Het
Smgc C A 15: 91,854,616 H492Q probably benign Het
Smyd4 G T 11: 75,403,184 G694V probably damaging Het
Sorcs3 A G 19: 48,398,744 T223A possibly damaging Het
Stab1 G T 14: 31,141,371 C2119* probably null Het
Taar9 A G 10: 24,108,843 I231T probably damaging Het
Tacr2 A G 10: 62,261,548 Y269C probably damaging Het
Taf3 T G 2: 9,951,123 K744N possibly damaging Het
Tenm4 T A 7: 96,906,245 V2682E probably damaging Het
Tet1 A C 10: 62,822,663 L1468R probably damaging Het
Tgds T C 14: 118,117,033 probably benign Het
Tgfb2 A T 1: 186,628,913 Y380* probably null Het
Tgm5 T G 2: 121,052,472 K435Q probably damaging Het
Themis A G 10: 28,761,511 T204A probably benign Het
Tm4sf1 T C 3: 57,294,679 Y37C probably damaging Het
Tnn T C 1: 160,145,033 N333S possibly damaging Het
Tppp2 A G 14: 51,919,348 N61D probably benign Het
Treml2 A G 17: 48,309,159 T276A probably benign Het
Trit1 T C 4: 123,016,638 V10A probably benign Het
Uba1y T G Y: 825,890 probably null Het
Uqcc1 T C 2: 155,858,106 probably benign Het
Vcam1 C G 3: 116,115,935 G581A probably damaging Het
Vmn1r16 G A 6: 57,323,190 T149I probably benign Het
Vmn1r209 T C 13: 22,805,656 D288G probably damaging Het
Vmn1r78 T A 7: 12,152,964 Y167* probably null Het
Vmn2r103 T A 17: 19,795,076 S493T probably benign Het
Vmn2r105 T A 17: 20,227,294 M423L probably benign Het
Vps13c T C 9: 67,964,282 F3244L probably damaging Het
Zfp119b A T 17: 55,939,642 D149E probably damaging Het
Zfp345 T C 2: 150,473,308 Y103C possibly damaging Het
Zmym6 C T 4: 127,123,216 T930I probably benign Het
Other mutations in Itpr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Itpr2 APN 6 146397012 missense probably damaging 0.99
IGL00163:Itpr2 APN 6 146390836 missense possibly damaging 0.88
IGL00229:Itpr2 APN 6 146144185 missense probably damaging 1.00
IGL00712:Itpr2 APN 6 146232436 missense possibly damaging 0.63
IGL00952:Itpr2 APN 6 146158961 missense probably damaging 1.00
IGL00983:Itpr2 APN 6 146310981 splice site probably benign
IGL01012:Itpr2 APN 6 146345161 missense probably damaging 1.00
IGL01289:Itpr2 APN 6 146112535 nonsense probably null
IGL01411:Itpr2 APN 6 146376062 critical splice donor site probably null
IGL01557:Itpr2 APN 6 146158976 missense probably damaging 0.99
IGL01669:Itpr2 APN 6 146180229 missense probably damaging 1.00
IGL01809:Itpr2 APN 6 146227581 missense probably damaging 1.00
IGL01814:Itpr2 APN 6 146232546 missense probably benign 0.02
IGL02198:Itpr2 APN 6 146323227 missense probably damaging 1.00
IGL02218:Itpr2 APN 6 146240262 splice site probably benign
IGL02332:Itpr2 APN 6 146426542 missense probably damaging 1.00
IGL02425:Itpr2 APN 6 146391321 missense probably damaging 0.99
IGL02432:Itpr2 APN 6 146325173 missense probably benign 0.05
IGL02726:Itpr2 APN 6 146375921 missense probably benign 0.18
IGL02851:Itpr2 APN 6 146385979 missense probably damaging 0.99
IGL02933:Itpr2 APN 6 146312904 missense probably benign
IGL03015:Itpr2 APN 6 146375937 missense probably benign
IGL03067:Itpr2 APN 6 146325182 missense probably damaging 1.00
IGL03093:Itpr2 APN 6 146379510 missense probably damaging 1.00
IGL03214:Itpr2 APN 6 146180244 missense probably benign 0.02
IGL03275:Itpr2 APN 6 146158877 splice site probably benign
IGL03332:Itpr2 APN 6 146144149 missense probably damaging 0.98
IGL03352:Itpr2 APN 6 146157104 missense probably damaging 1.00
IGL03377:Itpr2 APN 6 146329715 missense probably damaging 0.96
IGL03377:Itpr2 APN 6 146329758 missense probably benign
enfermos UTSW 6 146234006 missense probably damaging 0.98
P0029:Itpr2 UTSW 6 146379489 missense probably damaging 1.00
PIT4431001:Itpr2 UTSW 6 146354720 missense probably benign
PIT4453001:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
PIT4504001:Itpr2 UTSW 6 146229871 missense probably damaging 0.99
R0040:Itpr2 UTSW 6 146345140 missense probably damaging 1.00
R0040:Itpr2 UTSW 6 146345140 missense probably damaging 1.00
R0048:Itpr2 UTSW 6 146232291 splice site probably null
R0048:Itpr2 UTSW 6 146232291 splice site probably null
R0055:Itpr2 UTSW 6 146323133 missense probably benign 0.42
R0055:Itpr2 UTSW 6 146323133 missense probably benign 0.42
R0088:Itpr2 UTSW 6 146241185 missense probably benign
R0089:Itpr2 UTSW 6 146350022 critical splice donor site probably null
R0114:Itpr2 UTSW 6 146312879 missense probably damaging 1.00
R0125:Itpr2 UTSW 6 146240453 missense probably benign 0.00
R0144:Itpr2 UTSW 6 146327155 missense probably damaging 0.98
R0180:Itpr2 UTSW 6 146501909 start gained probably benign
R0211:Itpr2 UTSW 6 146194613 missense probably benign 0.17
R0305:Itpr2 UTSW 6 146311103 missense possibly damaging 0.63
R0367:Itpr2 UTSW 6 146234008 missense probably damaging 1.00
R0374:Itpr2 UTSW 6 146359392 missense probably benign 0.00
R0391:Itpr2 UTSW 6 146229773 missense probably damaging 1.00
R0450:Itpr2 UTSW 6 146417979 missense possibly damaging 0.66
R0464:Itpr2 UTSW 6 146375889 missense probably damaging 1.00
R0510:Itpr2 UTSW 6 146417979 missense possibly damaging 0.66
R0532:Itpr2 UTSW 6 146112400 missense probably damaging 1.00
R0625:Itpr2 UTSW 6 146166651 missense probably benign
R0633:Itpr2 UTSW 6 146374456 missense probably damaging 1.00
R0636:Itpr2 UTSW 6 146171412 missense probably damaging 1.00
R1086:Itpr2 UTSW 6 146350045 missense probably damaging 1.00
R1352:Itpr2 UTSW 6 146111742 missense probably damaging 1.00
R1631:Itpr2 UTSW 6 146180290 missense probably damaging 1.00
R1655:Itpr2 UTSW 6 146376148 missense probably damaging 1.00
R1767:Itpr2 UTSW 6 146350068 missense possibly damaging 0.91
R1779:Itpr2 UTSW 6 146158901 nonsense probably null
R1796:Itpr2 UTSW 6 146296673 missense probably benign
R1815:Itpr2 UTSW 6 146359416 missense probably benign 0.08
R1827:Itpr2 UTSW 6 146328332 missense probably damaging 1.00
R1828:Itpr2 UTSW 6 146328332 missense probably damaging 1.00
R1884:Itpr2 UTSW 6 146385971 missense probably benign 0.16
R1902:Itpr2 UTSW 6 146229703 missense probably damaging 1.00
R1931:Itpr2 UTSW 6 146240354 missense probably benign 0.41
R1964:Itpr2 UTSW 6 146111693 missense probably damaging 1.00
R2010:Itpr2 UTSW 6 146227524 synonymous probably null
R2168:Itpr2 UTSW 6 146111678 missense probably benign 0.05
R2179:Itpr2 UTSW 6 146375966 missense probably benign
R2290:Itpr2 UTSW 6 146422828 missense probably damaging 1.00
R2874:Itpr2 UTSW 6 146426498 missense possibly damaging 0.73
R2888:Itpr2 UTSW 6 146171293 missense probably damaging 1.00
R2897:Itpr2 UTSW 6 146173341 missense probably benign 0.03
R2897:Itpr2 UTSW 6 146323169 missense probably damaging 1.00
R2898:Itpr2 UTSW 6 146173341 missense probably benign 0.03
R2898:Itpr2 UTSW 6 146323169 missense probably damaging 1.00
R3024:Itpr2 UTSW 6 146180310 missense probably benign 0.35
R3104:Itpr2 UTSW 6 146312837 critical splice donor site probably null
R3607:Itpr2 UTSW 6 146227601 missense probably damaging 0.98
R3732:Itpr2 UTSW 6 146382700 missense probably damaging 1.00
R3732:Itpr2 UTSW 6 146382700 missense probably damaging 1.00
R3733:Itpr2 UTSW 6 146382700 missense probably damaging 1.00
R3792:Itpr2 UTSW 6 146415354 missense probably damaging 1.00
R3806:Itpr2 UTSW 6 146232291 splice site probably null
R3821:Itpr2 UTSW 6 146417726 missense probably damaging 1.00
R3929:Itpr2 UTSW 6 146374359 splice site probably null
R3958:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R3959:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R3960:Itpr2 UTSW 6 146229764 missense probably damaging 1.00
R3960:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R4074:Itpr2 UTSW 6 146373244 splice site probably null
R4085:Itpr2 UTSW 6 146144248 missense probably damaging 1.00
R4114:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R4115:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R4588:Itpr2 UTSW 6 146241196 missense probably benign 0.33
R4663:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4673:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4684:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4686:Itpr2 UTSW 6 146229775 missense probably damaging 1.00
R4713:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4713:Itpr2 UTSW 6 146396958 missense probably damaging 1.00
R4729:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4732:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4733:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4802:Itpr2 UTSW 6 146371331 missense probably damaging 1.00
R4877:Itpr2 UTSW 6 146325205 missense probably damaging 1.00
R4970:Itpr2 UTSW 6 146233991 missense possibly damaging 0.95
R4986:Itpr2 UTSW 6 146240342 missense probably damaging 0.96
R5112:Itpr2 UTSW 6 146233991 missense possibly damaging 0.95
R5200:Itpr2 UTSW 6 146144107 critical splice donor site probably null
R5224:Itpr2 UTSW 6 146166651 missense probably benign
R5243:Itpr2 UTSW 6 146187546 missense probably damaging 1.00
R5348:Itpr2 UTSW 6 146476693 missense possibly damaging 0.78
R5393:Itpr2 UTSW 6 146376155 nonsense probably null
R5552:Itpr2 UTSW 6 146294080 missense probably benign
R5579:Itpr2 UTSW 6 146173366 nonsense probably null
R5744:Itpr2 UTSW 6 146376151 missense probably damaging 1.00
R5825:Itpr2 UTSW 6 146144149 missense probably damaging 0.98
R5910:Itpr2 UTSW 6 146329571 missense probably benign 0.10
R5911:Itpr2 UTSW 6 146312943 missense probably benign 0.42
R6044:Itpr2 UTSW 6 146396951 missense probably null 0.98
R6072:Itpr2 UTSW 6 146347111 missense probably damaging 0.98
R6191:Itpr2 UTSW 6 146328335 missense probably benign 0.01
R6483:Itpr2 UTSW 6 146112477 missense possibly damaging 0.52
R6511:Itpr2 UTSW 6 146329727 missense probably damaging 1.00
R6524:Itpr2 UTSW 6 146345211 missense probably benign 0.01
R6561:Itpr2 UTSW 6 146234006 missense probably damaging 0.98
R6594:Itpr2 UTSW 6 146190480 missense possibly damaging 0.71
R6603:Itpr2 UTSW 6 146347171 missense probably damaging 0.98
R6736:Itpr2 UTSW 6 146325170 missense probably damaging 1.00
R6783:Itpr2 UTSW 6 146385873 critical splice donor site probably null
R6831:Itpr2 UTSW 6 146112429 missense probably damaging 1.00
R6857:Itpr2 UTSW 6 146397019 nonsense probably null
R7103:Itpr2 UTSW 6 146325074 missense probably damaging 1.00
R7111:Itpr2 UTSW 6 146325056 missense probably damaging 1.00
R7126:Itpr2 UTSW 6 146357796 nonsense probably null
R7165:Itpr2 UTSW 6 146294091 missense probably damaging 1.00
R7184:Itpr2 UTSW 6 146311087 missense possibly damaging 0.79
R7249:Itpr2 UTSW 6 146311052 missense probably damaging 1.00
R7292:Itpr2 UTSW 6 146158949 missense possibly damaging 0.95
V8831:Itpr2 UTSW 6 146385882 missense probably damaging 1.00
X0054:Itpr2 UTSW 6 146323236 missense probably damaging 1.00
X0063:Itpr2 UTSW 6 146180353 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGCCCCATCATGAGCCAATG -3'
(R):5'- GAGTTGGTCACAGTCTGAACC -3'

Sequencing Primer
(F):5'- GCCAATGTTTGCACAGACTG -3'
(R):5'- GGTCACAGTCTGAACCGTCTC -3'
Posted On2016-02-04