Incidental Mutation 'R4801:Myof'
ID370433
Institutional Source Beutler Lab
Gene Symbol Myof
Ensembl Gene ENSMUSG00000048612
Gene Namemyoferlin
SynonymsFer1l3, E030042N20Rik, 2310051D19Rik
MMRRC Submission 042423-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock #R4801 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location37899036-38043577 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37945738 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 908 (T908A)
Ref Sequence ENSEMBL: ENSMUSP00000045036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041475] [ENSMUST00000172095] [ENSMUST00000225159] [ENSMUST00000226068]
Predicted Effect probably benign
Transcript: ENSMUST00000041475
AA Change: T908A

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000045036
Gene: ENSMUSG00000048612
AA Change: T908A

DomainStartEndE-ValueType
C2 1 100 7.56e-16 SMART
low complexity region 142 159 N/A INTRINSIC
C2 200 299 4.03e-11 SMART
FerI 282 353 2.76e-37 SMART
C2 359 473 2.93e-13 SMART
low complexity region 532 543 N/A INTRINSIC
FerA 663 728 5.07e-27 SMART
FerB 755 829 2.39e-46 SMART
DysFN 843 901 6.42e-21 SMART
DysFN 914 970 1.16e-18 SMART
DysFC 979 1017 1.04e-11 SMART
DysFC 1037 1070 1.62e-8 SMART
C2 1127 1234 5.03e-12 SMART
C2 1289 1396 1.15e1 SMART
low complexity region 1425 1436 N/A INTRINSIC
low complexity region 1515 1526 N/A INTRINSIC
C2 1541 1640 2.66e-11 SMART
C2 1776 1905 2.81e-1 SMART
Pfam:Ferlin_C 1939 2043 2.4e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172095
AA Change: T908A

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000129792
Gene: ENSMUSG00000048612
AA Change: T908A

DomainStartEndE-ValueType
C2 1 100 7.56e-16 SMART
low complexity region 142 159 N/A INTRINSIC
C2 200 299 4.03e-11 SMART
FerI 282 353 2.76e-37 SMART
C2 359 473 2.93e-13 SMART
low complexity region 532 543 N/A INTRINSIC
FerA 663 728 5.07e-27 SMART
FerB 755 829 2.39e-46 SMART
DysFN 843 901 6.42e-21 SMART
DysFN 914 970 1.16e-18 SMART
DysFC 979 1017 1.04e-11 SMART
DysFC 1037 1070 1.62e-8 SMART
C2 1127 1234 5.03e-12 SMART
C2 1289 1396 1.15e1 SMART
low complexity region 1515 1526 N/A INTRINSIC
C2 1541 1640 2.66e-11 SMART
C2 1776 1905 2.81e-1 SMART
transmembrane domain 2013 2035 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223650
Predicted Effect probably benign
Transcript: ENSMUST00000225159
AA Change: T392A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000226068
AA Change: T921A

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the ferlin family of proteins, which have been implicated in fusion events in muscle tissue. Members of this family have a carboxy-terminal single pass transmembrane domain and multiple C2 domains, which bind negatively charged phospholipids in the presence of calcium ions. This gene is expressed at high levels in myoblasts and upregulated in damaged skeletal muscle. Mice deficient in this protein display defects in myoblast fusion, muscle regeneration, and angiogenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body size, impaired myogenesis, lack of large diameter myofibers, abnormal skeletal muscle regeneration after injury, and decreased vascular permeability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 164 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A G 10: 28,983,926 probably null Het
Aadacl3 A G 4: 144,456,232 I222T probably damaging Het
Abca13 G T 11: 9,522,341 G4249V possibly damaging Het
Abcb10 A G 8: 123,966,527 V346A probably benign Het
Abcc2 A T 19: 43,819,361 I814F probably damaging Het
AF366264 T A 8: 13,836,970 I374F possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd28 A C 14: 31,736,830 D335E probably damaging Het
Ankrd44 T C 1: 54,762,316 H284R probably damaging Het
Arfgef3 G T 10: 18,591,906 Q1849K probably benign Het
Atp2c2 T C 8: 119,747,687 M490T probably damaging Het
Bach1 T A 16: 87,722,452 D543E probably damaging Het
Bahcc1 G A 11: 120,282,225 V1558I probably benign Het
Bbs5 T A 2: 69,655,614 W168R probably damaging Het
Bcar3 A T 3: 122,529,594 D766V probably benign Het
C1ra A G 6: 124,513,768 D40G probably benign Het
Ccdc138 G A 10: 58,573,643 C598Y probably damaging Het
Cd200r3 T A 16: 44,957,825 N197K possibly damaging Het
Cenpf T A 1: 189,651,220 E2634D probably damaging Het
Cisd2 T C 3: 135,411,141 K63R probably damaging Het
Clca3a2 A T 3: 144,807,351 S478T possibly damaging Het
Clptm1l T C 13: 73,607,862 M199T possibly damaging Het
Cntnap4 T A 8: 112,773,590 S505T possibly damaging Het
Cr2 C T 1: 195,163,311 G112D probably damaging Het
Crb2 T A 2: 37,793,756 I1090N probably benign Het
Csmd3 G T 15: 47,621,292 P3057Q probably damaging Het
Ctso G A 3: 81,954,240 V307I probably damaging Het
Cyp3a41b T A 5: 145,573,651 T138S probably benign Het
Dctn3 G T 4: 41,719,904 Y67* probably null Het
Dennd4c C A 4: 86,819,884 Y918* probably null Het
Dlg5 C T 14: 24,154,689 G1262D probably damaging Het
Dnaaf1 G A 8: 119,577,361 G46D probably benign Het
Dnah6 A G 6: 73,089,698 V2563A probably damaging Het
Dnajc13 A G 9: 104,175,727 Y1679H probably benign Het
Eif2ak3 T C 6: 70,887,893 Y578H probably benign Het
Endod1 C T 9: 14,357,023 V389M probably benign Het
Ephb4 T C 5: 137,365,506 L582P probably damaging Het
Eps15 T C 4: 109,324,217 L316S possibly damaging Het
Erbb4 G T 1: 68,330,246 T412K probably damaging Het
Fam117a T A 11: 95,364,070 F90I probably damaging Het
Fam187b T G 7: 30,977,090 V8G possibly damaging Het
Fam84b C A 15: 60,823,944 probably benign Het
Far1 T A 7: 113,539,453 I59N possibly damaging Het
Fbxo34 T A 14: 47,530,869 L562Q probably damaging Het
Frem1 T A 4: 82,916,628 probably benign Het
Gfra3 G T 18: 34,720,192 P10Q probably damaging Het
Gm10698 A G 9: 33,728,772 noncoding transcript Het
Gm11487 C T 4: 73,401,267 W80* probably null Het
Gm19965 T A 1: 116,821,896 Y436N probably benign Het
Gm21818 T A 13: 120,173,222 S13R probably benign Het
Gm5767 A G 16: 8,683,345 T22A unknown Het
Gm5799 A T 14: 43,544,548 H59L probably damaging Het
Gmppb T A 9: 108,050,217 V121E probably benign Het
Ighv7-4 G C 12: 114,223,279 probably benign Het
Ipo4 A G 14: 55,631,214 S446P probably damaging Het
Itpr2 T C 6: 146,371,331 T855A probably damaging Het
Jaml T C 9: 45,101,064 I283T possibly damaging Het
Kcnn2 T C 18: 45,685,267 probably benign Het
Klhl32 T C 4: 24,649,698 Y399C possibly damaging Het
Lrriq1 G A 10: 103,221,318 T207I probably benign Het
Lrriq3 A T 3: 155,187,970 H436L probably benign Het
Mad2l1bp T C 17: 46,148,263 K114E possibly damaging Het
Mamstr T C 7: 45,642,418 V64A possibly damaging Het
Map4 T A 9: 110,035,257 S517T probably benign Het
Matn1 A T 4: 130,950,025 I182F possibly damaging Het
Mcm3 A G 1: 20,810,156 I484T probably damaging Het
Med13 T A 11: 86,278,773 I1922F probably damaging Het
Metap2 A G 10: 93,868,895 V137A probably damaging Het
Mex3d A G 10: 80,386,954 V156A possibly damaging Het
Mfsd6 G A 1: 52,709,596 P37S probably benign Het
Mkl1 T C 15: 81,104,799 E7G probably benign Het
Mrgprx1 A C 7: 48,021,211 S263A possibly damaging Het
Msl1 C T 11: 98,803,969 R505* probably null Het
Mta2 T C 19: 8,945,851 S96P probably damaging Het
Mtr A T 13: 12,195,251 N986K probably benign Het
Mut A G 17: 40,937,351 T90A probably benign Het
Mutyh C T 4: 116,817,029 T259I probably benign Het
Nav2 A T 7: 49,545,852 D992V possibly damaging Het
Neb T C 2: 52,200,703 T1352A possibly damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nudt6 G A 3: 37,405,354 R161C probably benign Het
Olfr1122 T A 2: 87,388,209 V168E probably benign Het
Olfr1173 T A 2: 88,274,879 M57L probably damaging Het
Olfr125 T C 17: 37,835,349 Y117H probably damaging Het
Olfr1276 T A 2: 111,257,152 F12L probably damaging Het
Olfr1411 T A 1: 92,596,998 C160S probably benign Het
Olfr154 T A 2: 85,664,278 D52V probably damaging Het
Olfr23 T A 11: 73,940,870 I208K possibly damaging Het
Olfr319 T C 11: 58,701,791 V30A probably benign Het
Olfr456 A T 6: 42,486,679 N171K probably benign Het
Olfr744 A G 14: 50,619,022 T267A probably benign Het
Olfr959 T G 9: 39,572,858 M134L probably benign Het
Olr1 A G 6: 129,488,090 F141S possibly damaging Het
Oprl1 G T 2: 181,719,253 M340I probably benign Het
Otogl A C 10: 107,901,336 C72W probably damaging Het
Pcdha11 T A 18: 37,005,465 I49N probably damaging Het
Pcdha4 T A 18: 36,953,955 L397* probably null Het
Pcdhb14 A G 18: 37,448,278 S146G probably benign Het
Pclo T A 5: 14,675,815 H1562Q unknown Het
Pcsk9 T C 4: 106,447,569 E434G probably benign Het
Phc2 A G 4: 128,751,598 K833E probably damaging Het
Pja2 A T 17: 64,292,862 S480R probably damaging Het
Pkd1 G A 17: 24,578,096 G2493D probably damaging Het
Plk5 G A 10: 80,359,304 V179M possibly damaging Het
Polr1a G A 6: 71,976,070 V1541I probably benign Het
Ppard C G 17: 28,286,374 R12G unknown Het
Ppp1r14a A G 7: 29,291,526 D73G probably damaging Het
Psd3 C T 8: 68,121,148 R127H probably benign Het
Pten G T 19: 32,758,503 G20V possibly damaging Het
Ptprg T C 14: 11,554,233 probably benign Het
Rad54l T C 4: 116,122,924 D21G probably null Het
Rgs14 T C 13: 55,380,957 Y304H probably damaging Het
Rgs9 T C 11: 109,240,868 K346R probably damaging Het
Rnf169 C G 7: 99,926,446 G314A probably damaging Het
Rpgrip1l T A 8: 91,270,177 T692S probably damaging Het
Rtf1 T C 2: 119,675,228 V54A possibly damaging Het
Rtn4 T C 11: 29,708,660 V938A probably benign Het
Ryr2 T A 13: 11,687,932 D2890V probably damaging Het
Ryr2 T C 13: 11,708,227 T2509A probably damaging Het
Scel A C 14: 103,583,100 T348P probably benign Het
Scgb1b2 G T 7: 31,291,573 L37I possibly damaging Het
Sdf4 A G 4: 156,000,721 H171R possibly damaging Het
Sec31a A G 5: 100,393,363 V295A probably damaging Het
Setx T A 2: 29,146,373 S957T probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Six5 A G 7: 19,096,969 N507S probably benign Het
Slc12a7 T C 13: 73,763,892 probably null Het
Slc1a7 T A 4: 107,993,040 V116E probably damaging Het
Slc22a1 A G 17: 12,675,535 L42P probably damaging Het
Slc25a31 A T 3: 40,721,545 I174F probably damaging Het
Slc31a2 A T 4: 62,292,632 M3L probably damaging Het
Slco1a4 T A 6: 141,845,497 probably benign Het
Smcr8 C T 11: 60,778,610 probably null Het
Smg5 G T 3: 88,355,692 E801* probably null Het
Smgc C A 15: 91,854,616 H492Q probably benign Het
Smyd4 G T 11: 75,403,184 G694V probably damaging Het
Sorcs3 A G 19: 48,398,744 T223A possibly damaging Het
Stab1 G T 14: 31,141,371 C2119* probably null Het
Taar9 A G 10: 24,108,843 I231T probably damaging Het
Tacr2 A G 10: 62,261,548 Y269C probably damaging Het
Taf3 T G 2: 9,951,123 K744N possibly damaging Het
Tenm4 T A 7: 96,906,245 V2682E probably damaging Het
Tet1 A C 10: 62,822,663 L1468R probably damaging Het
Tgds T C 14: 118,117,033 probably benign Het
Tgfb2 A T 1: 186,628,913 Y380* probably null Het
Tgm5 T G 2: 121,052,472 K435Q probably damaging Het
Themis A G 10: 28,761,511 T204A probably benign Het
Tm4sf1 T C 3: 57,294,679 Y37C probably damaging Het
Tnn T C 1: 160,145,033 N333S possibly damaging Het
Tppp2 A G 14: 51,919,348 N61D probably benign Het
Treml2 A G 17: 48,309,159 T276A probably benign Het
Trit1 T C 4: 123,016,638 V10A probably benign Het
Uba1y T G Y: 825,890 probably null Het
Uqcc1 T C 2: 155,858,106 probably benign Het
Vcam1 C G 3: 116,115,935 G581A probably damaging Het
Vmn1r16 G A 6: 57,323,190 T149I probably benign Het
Vmn1r209 T C 13: 22,805,656 D288G probably damaging Het
Vmn1r78 T A 7: 12,152,964 Y167* probably null Het
Vmn2r103 T A 17: 19,795,076 S493T probably benign Het
Vmn2r105 T A 17: 20,227,294 M423L probably benign Het
Vps13c T C 9: 67,964,282 F3244L probably damaging Het
Zfp119b A T 17: 55,939,642 D149E probably damaging Het
Zfp345 T C 2: 150,473,308 Y103C possibly damaging Het
Zmym6 C T 4: 127,123,216 T930I probably benign Het
Other mutations in Myof
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Myof APN 19 37960934 missense probably benign 0.16
IGL00764:Myof APN 19 37974923 missense probably benign 0.04
IGL00801:Myof APN 19 37986073 missense probably damaging 0.99
IGL01084:Myof APN 19 37936436 missense probably damaging 1.00
IGL01368:Myof APN 19 37936457 missense probably damaging 0.97
IGL01472:Myof APN 19 37923076 missense probably benign
IGL01785:Myof APN 19 37980423 nonsense probably null
IGL02205:Myof APN 19 37924635 missense probably damaging 1.00
IGL02268:Myof APN 19 37954429 missense possibly damaging 0.50
IGL02268:Myof APN 19 37974863 missense possibly damaging 0.90
IGL02339:Myof APN 19 37972213 missense possibly damaging 0.46
IGL02433:Myof APN 19 37972193 missense probably benign 0.05
IGL02481:Myof APN 19 37937913 nonsense probably null
IGL02536:Myof APN 19 37949655 missense probably damaging 0.97
IGL02682:Myof APN 19 37921481 missense probably benign 0.09
IGL02732:Myof APN 19 37977716 missense possibly damaging 0.50
IGL02887:Myof APN 19 37920779 critical splice acceptor site probably null
IGL03114:Myof APN 19 37903861 missense probably damaging 1.00
IGL03137:Myof APN 19 37974889 missense probably damaging 1.00
IGL03340:Myof APN 19 37911159 missense probably damaging 1.00
PIT4791001:Myof UTSW 19 37982958 critical splice donor site probably null
R0024:Myof UTSW 19 37915740 missense probably damaging 0.98
R0140:Myof UTSW 19 37951556 nonsense probably null
R0309:Myof UTSW 19 37981266 missense probably benign 0.12
R0330:Myof UTSW 19 37935878 missense probably damaging 1.00
R0345:Myof UTSW 19 38024345 missense probably damaging 1.00
R0349:Myof UTSW 19 37910969 missense probably damaging 0.99
R0463:Myof UTSW 19 37916504 missense probably damaging 1.00
R0507:Myof UTSW 19 37901277 missense possibly damaging 0.94
R0512:Myof UTSW 19 37954524 missense possibly damaging 0.54
R0608:Myof UTSW 19 37916504 missense probably damaging 1.00
R0723:Myof UTSW 19 37981260 missense probably damaging 1.00
R1081:Myof UTSW 19 37986088 missense probably damaging 0.99
R1196:Myof UTSW 19 37910960 missense probably damaging 1.00
R1243:Myof UTSW 19 37936092 missense probably damaging 1.00
R1371:Myof UTSW 19 37903668 splice site probably benign
R1381:Myof UTSW 19 37995485 missense probably damaging 1.00
R1419:Myof UTSW 19 37901911 missense probably damaging 1.00
R1527:Myof UTSW 19 37924619 missense probably damaging 1.00
R1672:Myof UTSW 19 37943479 missense probably damaging 1.00
R1864:Myof UTSW 19 37986705 missense probably benign
R1914:Myof UTSW 19 37977693 missense probably damaging 1.00
R1915:Myof UTSW 19 37977693 missense probably damaging 1.00
R1970:Myof UTSW 19 37945634 missense probably damaging 0.99
R2062:Myof UTSW 19 37915746 missense possibly damaging 0.94
R2144:Myof UTSW 19 37981221 critical splice donor site probably null
R2243:Myof UTSW 19 37901319 missense probably damaging 1.00
R2339:Myof UTSW 19 37937927 missense probably damaging 1.00
R2484:Myof UTSW 19 37903843 missense probably benign 0.13
R2880:Myof UTSW 19 37923025 missense probably benign 0.04
R3418:Myof UTSW 19 37922978 missense probably damaging 0.97
R3967:Myof UTSW 19 37901263 missense probably damaging 1.00
R3967:Myof UTSW 19 38022610 missense possibly damaging 0.59
R3970:Myof UTSW 19 37901263 missense probably damaging 1.00
R3970:Myof UTSW 19 38022610 missense possibly damaging 0.59
R4238:Myof UTSW 19 37923008 nonsense probably null
R4405:Myof UTSW 19 37922978 missense probably damaging 0.97
R4406:Myof UTSW 19 37922978 missense probably damaging 0.97
R4407:Myof UTSW 19 37922978 missense probably damaging 0.97
R4408:Myof UTSW 19 37922978 missense probably damaging 0.97
R4561:Myof UTSW 19 37922990 missense probably benign
R4606:Myof UTSW 19 37967099 missense probably damaging 1.00
R4778:Myof UTSW 19 37949563 missense probably damaging 1.00
R4802:Myof UTSW 19 37945738 missense probably benign 0.24
R4812:Myof UTSW 19 37916559 missense probably damaging 1.00
R4884:Myof UTSW 19 37942357 missense probably damaging 1.00
R4964:Myof UTSW 19 37935852 missense probably damaging 0.97
R4966:Myof UTSW 19 37935852 missense probably damaging 0.97
R5069:Myof UTSW 19 37905325 missense possibly damaging 0.65
R5181:Myof UTSW 19 37932623 missense possibly damaging 0.95
R5376:Myof UTSW 19 37916400 missense probably damaging 1.00
R5384:Myof UTSW 19 37952987 missense probably damaging 0.98
R5543:Myof UTSW 19 37981330 missense probably benign 0.00
R5626:Myof UTSW 19 37922990 missense probably benign
R5865:Myof UTSW 19 37910934 missense probably damaging 1.00
R5919:Myof UTSW 19 38024370 missense possibly damaging 0.95
R5924:Myof UTSW 19 37982973 missense probably damaging 0.97
R5997:Myof UTSW 19 37905299 missense possibly damaging 0.90
R5999:Myof UTSW 19 37939856 nonsense probably null
R6039:Myof UTSW 19 37977684 missense probably damaging 1.00
R6039:Myof UTSW 19 37977684 missense probably damaging 1.00
R6041:Myof UTSW 19 37924620 missense probably damaging 1.00
R6051:Myof UTSW 19 38024361 missense probably damaging 1.00
R6057:Myof UTSW 19 37926981 critical splice donor site probably null
R6089:Myof UTSW 19 37967060 missense probably benign 0.37
R6195:Myof UTSW 19 37913357 missense possibly damaging 0.89
R6478:Myof UTSW 19 37903831 missense probably damaging 1.00
R6545:Myof UTSW 19 37942297 missense possibly damaging 0.67
R6655:Myof UTSW 19 37934791 missense probably damaging 1.00
R6715:Myof UTSW 19 37968346 missense probably benign 0.04
R6737:Myof UTSW 19 37943514 missense probably benign 0.01
R6837:Myof UTSW 19 37922956 critical splice donor site probably null
R7096:Myof UTSW 19 37936200 missense probably damaging 1.00
R7308:Myof UTSW 19 37910911 missense probably damaging 0.98
X0024:Myof UTSW 19 37974597 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- ATGGAGCATGCCCCATGATG -3'
(R):5'- ATAATTTAGGTCTCACTGCCCCAC -3'

Sequencing Primer
(F):5'- CATGATGCACAGCGACTGGAC -3'
(R):5'- CCTTTCTCCAAATGAATGTCAAAAGC -3'
Posted On2016-02-04