Incidental Mutation 'R0421:Mdn1'
ID37045
Institutional Source Beutler Lab
Gene Symbol Mdn1
Ensembl Gene ENSMUSG00000058006
Gene Namemidasin AAA ATPase 1
Synonyms4833432B22Rik, LOC213784, D4Abb1e
MMRRC Submission 038623-MU
Accession Numbers

Genbank: NM_001081392; MGI: 1926159

Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R0421 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location32657119-32775217 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32684707 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 806 (T806A)
Ref Sequence ENSEMBL: ENSMUSP00000136222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071642] [ENSMUST00000178134]
Predicted Effect probably benign
Transcript: ENSMUST00000071642
AA Change: T806A

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000071569
Gene: ENSMUSG00000058006
AA Change: T806A

DomainStartEndE-ValueType
low complexity region 48 75 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
Pfam:AAA_5 324 459 7.4e-19 PFAM
AAA 666 908 1.06e-6 SMART
AAA 1072 1217 2.09e-1 SMART
AAA 1378 1544 8.27e-9 SMART
AAA 1740 1893 6.78e-2 SMART
AAA 2053 2309 1.62e0 SMART
low complexity region 3181 3193 N/A INTRINSIC
low complexity region 3541 3552 N/A INTRINSIC
low complexity region 3557 3565 N/A INTRINSIC
low complexity region 4189 4203 N/A INTRINSIC
low complexity region 4339 4353 N/A INTRINSIC
low complexity region 4672 4681 N/A INTRINSIC
low complexity region 4735 4756 N/A INTRINSIC
low complexity region 4769 4790 N/A INTRINSIC
low complexity region 4886 4905 N/A INTRINSIC
low complexity region 4924 4937 N/A INTRINSIC
coiled coil region 4957 4983 N/A INTRINSIC
low complexity region 5000 5017 N/A INTRINSIC
low complexity region 5176 5192 N/A INTRINSIC
low complexity region 5315 5329 N/A INTRINSIC
VWA 5375 5556 2.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178134
AA Change: T806A

PolyPhen 2 Score 0.393 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000136222
Gene: ENSMUSG00000058006
AA Change: T806A

DomainStartEndE-ValueType
low complexity region 48 75 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
Pfam:AAA_5 324 459 4.4e-19 PFAM
AAA 666 908 1.06e-6 SMART
AAA 1072 1217 2.09e-1 SMART
AAA 1378 1544 8.27e-9 SMART
AAA 1740 1893 6.78e-2 SMART
AAA 2053 2309 1.62e0 SMART
low complexity region 3181 3193 N/A INTRINSIC
low complexity region 3541 3552 N/A INTRINSIC
low complexity region 3557 3565 N/A INTRINSIC
low complexity region 4189 4203 N/A INTRINSIC
low complexity region 4339 4353 N/A INTRINSIC
low complexity region 4667 4676 N/A INTRINSIC
low complexity region 4730 4751 N/A INTRINSIC
low complexity region 4764 4785 N/A INTRINSIC
low complexity region 4881 4900 N/A INTRINSIC
low complexity region 4919 4932 N/A INTRINSIC
coiled coil region 4952 4978 N/A INTRINSIC
low complexity region 4992 5010 N/A INTRINSIC
low complexity region 5169 5185 N/A INTRINSIC
low complexity region 5308 5322 N/A INTRINSIC
VWA 5368 5549 2.73e-6 SMART
Meta Mutation Damage Score 0.084 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 97% (67/69)
Allele List at MGI

All alleles(29) : Targeted, other(2) Gene trapped(27)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik T C 3: 92,868,984 T131A probably damaging Het
Abi1 G A 2: 22,960,827 T195I probably damaging Het
Afap1l1 T C 18: 61,751,874 N180S probably damaging Het
Arsg A G 11: 109,527,766 Y196C probably damaging Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
Atp2b2 C A 6: 113,813,888 R185L probably damaging Het
Ccr9 A T 9: 123,779,606 M118L probably benign Het
Cdh12 A T 15: 21,480,224 probably null Het
Cdk13 T C 13: 17,763,170 S763G probably damaging Het
Cenpk C A 13: 104,242,403 N177K probably benign Het
Cfap43 T G 19: 47,835,575 N119T probably benign Het
Chrna6 T C 8: 27,408,387 E101G probably null Het
Clasp2 G A 9: 113,854,302 R400H probably benign Het
Col6a6 T C 9: 105,784,206 M235V probably benign Het
Ddx49 A T 8: 70,295,632 L291Q probably damaging Het
Dhrs7 A T 12: 72,653,086 probably benign Het
Dnah5 A T 15: 28,229,541 K107M possibly damaging Het
Dsg2 C T 18: 20,579,391 R151C probably damaging Het
Dsn1 T C 2: 157,005,869 T2A possibly damaging Het
Edem3 A G 1: 151,792,438 probably benign Het
Eif3c T C 7: 126,563,712 N133S possibly damaging Het
F10 A G 8: 13,045,097 K85E probably benign Het
Fam129a T A 1: 151,709,082 probably benign Het
Fam57b G A 7: 126,825,015 V44M probably damaging Het
Fbn2 T A 18: 58,027,804 probably benign Het
Gtpbp10 A T 5: 5,557,290 H50Q probably benign Het
Hephl1 A G 9: 15,059,160 F1013L probably benign Het
Hps3 C A 3: 20,029,316 V238F probably benign Het
Kcna10 A C 3: 107,194,504 K150N probably damaging Het
Kirrel C T 3: 87,083,607 G636D probably damaging Het
Kndc1 G A 7: 139,908,996 R189H probably damaging Het
Knop1 C T 7: 118,855,629 E50K possibly damaging Het
Kpna7 T A 5: 144,989,741 H467L possibly damaging Het
Lcn4 T C 2: 26,668,649 N142D possibly damaging Het
Map3k3 T C 11: 106,148,915 probably benign Het
Nbeal1 T A 1: 60,268,439 N1703K probably benign Het
Neurl4 T C 11: 69,908,534 V914A probably damaging Het
Nop56 T C 2: 130,276,772 S275P possibly damaging Het
Olfr352 A G 2: 36,869,641 E25G possibly damaging Het
Olfr655 A G 7: 104,596,722 V153A probably benign Het
Olfr868 A G 9: 20,101,475 K239E probably damaging Het
Otof A C 5: 30,371,568 I1827S possibly damaging Het
Pappa2 A T 1: 158,848,080 I1032N probably damaging Het
Pcdh7 A G 5: 57,720,060 E319G probably damaging Het
Pcdhb11 T A 18: 37,422,480 S288T probably benign Het
Phip A T 9: 82,926,457 D488E probably damaging Het
Pla2g7 A T 17: 43,611,412 H394L probably damaging Het
Plk3 A G 4: 117,133,444 V69A probably damaging Het
Prob1 C A 18: 35,653,030 A724S possibly damaging Het
Prune2 T C 19: 17,123,311 F2060L probably benign Het
Rgl3 G A 9: 21,976,032 R498C probably benign Het
Rnf213 A C 11: 119,447,257 N3362H probably damaging Het
Sbds A G 5: 130,253,933 probably benign Het
Scn9a T C 2: 66,543,277 S453G probably benign Het
Sh3rf3 T C 10: 58,984,075 L236P probably damaging Het
Skint1 A G 4: 112,019,014 N44S possibly damaging Het
Slc5a1 T A 5: 33,134,652 I141N probably damaging Het
Trank1 T A 9: 111,391,839 I2548N probably damaging Het
Tsc22d2 G A 3: 58,417,328 probably benign Het
Unc13c T A 9: 73,933,210 I120F possibly damaging Het
Vmn2r11 T G 5: 109,059,428 I9L probably benign Het
Vmn2r58 T G 7: 41,865,204 N114H probably benign Het
Vps53 A G 11: 76,082,670 L166P probably damaging Het
Zfp119a T A 17: 55,865,248 K532* probably null Het
Zfp472 A G 17: 32,975,923 T11A possibly damaging Het
Zfp512b T A 2: 181,588,258 K87* probably null Het
Zfp518b G A 5: 38,674,575 P29L probably damaging Het
Zfp599 A G 9: 22,250,547 probably benign Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Mdn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Mdn1 APN 4 32723651 missense probably damaging 1.00
IGL00426:Mdn1 APN 4 32719214 missense possibly damaging 0.91
IGL00570:Mdn1 APN 4 32735719 missense probably benign
IGL00573:Mdn1 APN 4 32666619 critical splice donor site probably null
IGL00983:Mdn1 APN 4 32735525 missense probably damaging 1.00
IGL01288:Mdn1 APN 4 32730864 missense probably benign 0.00
IGL01359:Mdn1 APN 4 32743686 missense probably benign 0.10
IGL01457:Mdn1 APN 4 32715922 missense possibly damaging 0.82
IGL01530:Mdn1 APN 4 32711938 splice site probably benign
IGL01684:Mdn1 APN 4 32726857 missense probably benign
IGL01753:Mdn1 APN 4 32708483 missense probably benign
IGL01901:Mdn1 APN 4 32669591 missense probably damaging 1.00
IGL01952:Mdn1 APN 4 32723657 missense possibly damaging 0.82
IGL01960:Mdn1 APN 4 32758393 missense probably benign 0.14
IGL02019:Mdn1 APN 4 32749948 missense possibly damaging 0.93
IGL02100:Mdn1 APN 4 32715708 missense possibly damaging 0.90
IGL02117:Mdn1 APN 4 32709364 missense probably benign 0.00
IGL02154:Mdn1 APN 4 32740395 missense probably benign 0.35
IGL02216:Mdn1 APN 4 32739092 missense probably benign 0.03
IGL02371:Mdn1 APN 4 32676860
IGL02396:Mdn1 APN 4 32700120 missense probably damaging 0.99
IGL02454:Mdn1 APN 4 32694674 critical splice donor site probably null
IGL02502:Mdn1 APN 4 32670579 missense possibly damaging 0.69
IGL02883:Mdn1 APN 4 32763199 missense probably benign 0.05
IGL02946:Mdn1 APN 4 32734366 missense probably damaging 0.98
IGL02950:Mdn1 APN 4 32713360 splice site probably benign
IGL03076:Mdn1 APN 4 32735564 missense probably damaging 0.97
IGL03129:Mdn1 APN 4 32729994 missense possibly damaging 0.47
IGL03234:Mdn1 APN 4 32732842 missense probably benign 0.06
3-1:Mdn1 UTSW 4 32725967 critical splice donor site probably null
IGL03046:Mdn1 UTSW 4 32694495 missense possibly damaging 0.73
P0035:Mdn1 UTSW 4 32749934 missense probably benign 0.05
R0008:Mdn1 UTSW 4 32718317 missense possibly damaging 0.47
R0110:Mdn1 UTSW 4 32738619 missense probably benign 0.20
R0125:Mdn1 UTSW 4 32729956 missense probably damaging 0.98
R0257:Mdn1 UTSW 4 32693534 missense probably damaging 0.99
R0266:Mdn1 UTSW 4 32741835 missense probably damaging 0.99
R0349:Mdn1 UTSW 4 32750318 missense probably damaging 1.00
R0362:Mdn1 UTSW 4 32746439 critical splice acceptor site probably null
R0450:Mdn1 UTSW 4 32738619 missense probably benign 0.20
R0465:Mdn1 UTSW 4 32699204 splice site probably benign
R0469:Mdn1 UTSW 4 32738619 missense probably benign 0.20
R0477:Mdn1 UTSW 4 32750928 missense probably benign 0.02
R0481:Mdn1 UTSW 4 32767182 splice site probably benign
R0504:Mdn1 UTSW 4 32698916 splice site probably benign
R0522:Mdn1 UTSW 4 32672837 missense probably benign 0.09
R0550:Mdn1 UTSW 4 32730479 missense probably benign 0.13
R0607:Mdn1 UTSW 4 32712014 missense probably damaging 1.00
R0607:Mdn1 UTSW 4 32732829 missense probably benign 0.36
R0664:Mdn1 UTSW 4 32768011 nonsense probably null
R0701:Mdn1 UTSW 4 32699263 missense probably benign 0.00
R0801:Mdn1 UTSW 4 32668895 missense probably benign 0.04
R0841:Mdn1 UTSW 4 32752032 missense probably benign 0.23
R0849:Mdn1 UTSW 4 32741835 missense probably damaging 0.99
R0893:Mdn1 UTSW 4 32701713 missense probably benign 0.01
R1114:Mdn1 UTSW 4 32746568 critical splice donor site probably null
R1137:Mdn1 UTSW 4 32694511 missense probably damaging 1.00
R1185:Mdn1 UTSW 4 32735576 missense possibly damaging 0.94
R1185:Mdn1 UTSW 4 32735576 missense possibly damaging 0.94
R1185:Mdn1 UTSW 4 32735576 missense possibly damaging 0.94
R1257:Mdn1 UTSW 4 32667089 critical splice acceptor site probably null
R1356:Mdn1 UTSW 4 32700334 splice site probably benign
R1466:Mdn1 UTSW 4 32730788 missense probably benign 0.28
R1466:Mdn1 UTSW 4 32730788 missense probably benign 0.28
R1518:Mdn1 UTSW 4 32739977 missense probably damaging 1.00
R1569:Mdn1 UTSW 4 32723501 missense probably null 0.10
R1574:Mdn1 UTSW 4 32722315 missense probably benign
R1574:Mdn1 UTSW 4 32722315 missense probably benign
R1591:Mdn1 UTSW 4 32700092 missense possibly damaging 0.65
R1678:Mdn1 UTSW 4 32663050 missense probably damaging 0.99
R1696:Mdn1 UTSW 4 32700417 missense possibly damaging 0.91
R1707:Mdn1 UTSW 4 32693504 missense probably damaging 1.00
R1749:Mdn1 UTSW 4 32773952 missense probably damaging 1.00
R1780:Mdn1 UTSW 4 32700103 missense probably damaging 1.00
R1833:Mdn1 UTSW 4 32720761 missense probably damaging 0.97
R1858:Mdn1 UTSW 4 32730881 missense probably benign 0.17
R1870:Mdn1 UTSW 4 32763339 missense probably damaging 1.00
R1887:Mdn1 UTSW 4 32742540 missense probably damaging 1.00
R1909:Mdn1 UTSW 4 32760839 small deletion probably benign
R2075:Mdn1 UTSW 4 32716058 missense probably benign 0.03
R2103:Mdn1 UTSW 4 32738712 missense possibly damaging 0.75
R2104:Mdn1 UTSW 4 32743843 splice site probably null
R2110:Mdn1 UTSW 4 32700409 missense probably damaging 1.00
R2111:Mdn1 UTSW 4 32700409 missense probably damaging 1.00
R2206:Mdn1 UTSW 4 32716271 missense possibly damaging 0.71
R2221:Mdn1 UTSW 4 32763306 missense probably benign 0.37
R2240:Mdn1 UTSW 4 32765701 missense possibly damaging 0.90
R2351:Mdn1 UTSW 4 32750010 missense probably benign 0.21
R2421:Mdn1 UTSW 4 32723621 missense probably damaging 0.96
R3036:Mdn1 UTSW 4 32750013 missense probably damaging 0.99
R3434:Mdn1 UTSW 4 32733726 critical splice donor site probably null
R3435:Mdn1 UTSW 4 32733726 critical splice donor site probably null
R3783:Mdn1 UTSW 4 32720818 missense probably benign 0.01
R3811:Mdn1 UTSW 4 32693506 nonsense probably null
R3973:Mdn1 UTSW 4 32722363 missense probably benign 0.00
R4154:Mdn1 UTSW 4 32707475 missense probably damaging 0.96
R4372:Mdn1 UTSW 4 32743809 missense probably benign 0.03
R4393:Mdn1 UTSW 4 32754482 missense possibly damaging 0.48
R4438:Mdn1 UTSW 4 32704635 missense probably damaging 1.00
R4471:Mdn1 UTSW 4 32668860 missense probably benign 0.00
R4509:Mdn1 UTSW 4 32715883 missense probably damaging 1.00
R4538:Mdn1 UTSW 4 32722334 missense probably damaging 1.00
R4557:Mdn1 UTSW 4 32754437 missense probably damaging 1.00
R4570:Mdn1 UTSW 4 32741812 missense probably damaging 1.00
R4591:Mdn1 UTSW 4 32707636 missense probably damaging 1.00
R4658:Mdn1 UTSW 4 32730749 splice site probably null
R4667:Mdn1 UTSW 4 32679572 missense probably damaging 1.00
R4684:Mdn1 UTSW 4 32666430 missense probably damaging 1.00
R4778:Mdn1 UTSW 4 32683583 nonsense probably null
R4807:Mdn1 UTSW 4 32685651 splice site probably null
R4923:Mdn1 UTSW 4 32671608 missense possibly damaging 0.89
R4951:Mdn1 UTSW 4 32707459 missense probably damaging 1.00
R4963:Mdn1 UTSW 4 32756512 missense probably benign 0.00
R4971:Mdn1 UTSW 4 32739827 missense probably damaging 1.00
R4973:Mdn1 UTSW 4 32734418 missense probably benign 0.01
R5122:Mdn1 UTSW 4 32670593 missense probably damaging 1.00
R5159:Mdn1 UTSW 4 32774008 missense possibly damaging 0.93
R5164:Mdn1 UTSW 4 32759011 intron probably null
R5215:Mdn1 UTSW 4 32741418 missense possibly damaging 0.78
R5217:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5219:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5365:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5366:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5368:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5445:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5462:Mdn1 UTSW 4 32720897 missense probably benign
R5522:Mdn1 UTSW 4 32685783 missense probably damaging 1.00
R5525:Mdn1 UTSW 4 32767961 missense possibly damaging 0.73
R5578:Mdn1 UTSW 4 32728167 missense probably benign 0.04
R5605:Mdn1 UTSW 4 32765664 missense probably benign
R5621:Mdn1 UTSW 4 32716371 missense possibly damaging 0.46
R5636:Mdn1 UTSW 4 32695480 missense probably damaging 1.00
R5650:Mdn1 UTSW 4 32667467 splice site probably null
R5780:Mdn1 UTSW 4 32722950 missense probably benign 0.02
R5838:Mdn1 UTSW 4 32754547 missense probably damaging 0.99
R5857:Mdn1 UTSW 4 32670646 missense probably benign 0.09
R5895:Mdn1 UTSW 4 32695400 missense probably damaging 1.00
R5943:Mdn1 UTSW 4 32678330 missense probably damaging 1.00
R6008:Mdn1 UTSW 4 32741073 missense probably damaging 1.00
R6013:Mdn1 UTSW 4 32715713 missense probably damaging 1.00
R6075:Mdn1 UTSW 4 32689581 missense possibly damaging 0.48
R6151:Mdn1 UTSW 4 32684735 missense probably damaging 1.00
R6163:Mdn1 UTSW 4 32716040 missense probably damaging 1.00
R6181:Mdn1 UTSW 4 32715953 missense probably damaging 1.00
R6211:Mdn1 UTSW 4 32696269 missense probably benign 0.12
R6249:Mdn1 UTSW 4 32708484 missense possibly damaging 0.85
R6251:Mdn1 UTSW 4 32748590 missense probably benign 0.13
R6253:Mdn1 UTSW 4 32749593 missense probably benign 0.25
R6273:Mdn1 UTSW 4 32715979 missense probably benign 0.01
R6297:Mdn1 UTSW 4 32730054 nonsense probably null
R6384:Mdn1 UTSW 4 32670607 missense probably damaging 1.00
R6463:Mdn1 UTSW 4 32773308 missense probably damaging 1.00
R6528:Mdn1 UTSW 4 32713780 missense probably damaging 1.00
R6688:Mdn1 UTSW 4 32774041 missense possibly damaging 0.74
R6762:Mdn1 UTSW 4 32676786 missense possibly damaging 0.50
R6794:Mdn1 UTSW 4 32741893 missense probably damaging 1.00
R6894:Mdn1 UTSW 4 32748614 missense possibly damaging 0.75
R6935:Mdn1 UTSW 4 32774041 missense possibly damaging 0.74
X0066:Mdn1 UTSW 4 32739030 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTATCACAGTAAGCCTGAAAGCGG -3'
(R):5'- TCACTTGGAAAACTATGCTGGAGCC -3'

Sequencing Primer
(F):5'- cctgaaagcggagagcac -3'
(R):5'- AACTATGCTGGAGCCAGTACTTG -3'
Posted On2013-05-09