Incidental Mutation 'R0421:Slc5a1'
ID37050
Institutional Source Beutler Lab
Gene Symbol Slc5a1
Ensembl Gene ENSMUSG00000011034
Gene Namesolute carrier family 5 (sodium/glucose cotransporter), member 1
SynonymsSglt1, sodium glucose cotransporter 1
MMRRC Submission 038623-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R0421 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location33104219-33162870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33134652 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 141 (I141N)
Ref Sequence ENSEMBL: ENSMUSP00000011178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011178]
Predicted Effect probably damaging
Transcript: ENSMUST00000011178
AA Change: I141N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000011178
Gene: ENSMUSG00000011034
AA Change: I141N

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Pfam:SSF 58 492 2.6e-174 PFAM
transmembrane domain 526 548 N/A INTRINSIC
low complexity region 620 634 N/A INTRINSIC
transmembrane domain 641 663 N/A INTRINSIC
Meta Mutation Damage Score 0.362 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-dependent glucose transporter (SGLT) family. The encoded integral membrane protein is the primary mediator of dietary glucose and galactose uptake from the intestinal lumen. Mutations in this gene have been associated with glucose-galactose malabsorption. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality unless maintained on a glucose-galatose-free diet, distended intestine, impaired glucose transport across the brush border membrane and impaired renal glucose reabsorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik T C 3: 92,868,984 T131A probably damaging Het
Abi1 G A 2: 22,960,827 T195I probably damaging Het
Afap1l1 T C 18: 61,751,874 N180S probably damaging Het
Arsg A G 11: 109,527,766 Y196C probably damaging Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
Atp2b2 C A 6: 113,813,888 R185L probably damaging Het
Ccr9 A T 9: 123,779,606 M118L probably benign Het
Cdh12 A T 15: 21,480,224 probably null Het
Cdk13 T C 13: 17,763,170 S763G probably damaging Het
Cenpk C A 13: 104,242,403 N177K probably benign Het
Cfap43 T G 19: 47,835,575 N119T probably benign Het
Chrna6 T C 8: 27,408,387 E101G probably null Het
Clasp2 G A 9: 113,854,302 R400H probably benign Het
Col6a6 T C 9: 105,784,206 M235V probably benign Het
Ddx49 A T 8: 70,295,632 L291Q probably damaging Het
Dhrs7 A T 12: 72,653,086 probably benign Het
Dnah5 A T 15: 28,229,541 K107M possibly damaging Het
Dsg2 C T 18: 20,579,391 R151C probably damaging Het
Dsn1 T C 2: 157,005,869 T2A possibly damaging Het
Edem3 A G 1: 151,792,438 probably benign Het
Eif3c T C 7: 126,563,712 N133S possibly damaging Het
F10 A G 8: 13,045,097 K85E probably benign Het
Fam129a T A 1: 151,709,082 probably benign Het
Fam57b G A 7: 126,825,015 V44M probably damaging Het
Fbn2 T A 18: 58,027,804 probably benign Het
Gtpbp10 A T 5: 5,557,290 H50Q probably benign Het
Hephl1 A G 9: 15,059,160 F1013L probably benign Het
Hps3 C A 3: 20,029,316 V238F probably benign Het
Kcna10 A C 3: 107,194,504 K150N probably damaging Het
Kirrel C T 3: 87,083,607 G636D probably damaging Het
Kndc1 G A 7: 139,908,996 R189H probably damaging Het
Knop1 C T 7: 118,855,629 E50K possibly damaging Het
Kpna7 T A 5: 144,989,741 H467L possibly damaging Het
Lcn4 T C 2: 26,668,649 N142D possibly damaging Het
Map3k3 T C 11: 106,148,915 probably benign Het
Mdn1 A G 4: 32,684,707 T806A probably benign Het
Nbeal1 T A 1: 60,268,439 N1703K probably benign Het
Neurl4 T C 11: 69,908,534 V914A probably damaging Het
Nop56 T C 2: 130,276,772 S275P possibly damaging Het
Olfr352 A G 2: 36,869,641 E25G possibly damaging Het
Olfr655 A G 7: 104,596,722 V153A probably benign Het
Olfr868 A G 9: 20,101,475 K239E probably damaging Het
Otof A C 5: 30,371,568 I1827S possibly damaging Het
Pappa2 A T 1: 158,848,080 I1032N probably damaging Het
Pcdh7 A G 5: 57,720,060 E319G probably damaging Het
Pcdhb11 T A 18: 37,422,480 S288T probably benign Het
Phip A T 9: 82,926,457 D488E probably damaging Het
Pla2g7 A T 17: 43,611,412 H394L probably damaging Het
Plk3 A G 4: 117,133,444 V69A probably damaging Het
Prob1 C A 18: 35,653,030 A724S possibly damaging Het
Prune2 T C 19: 17,123,311 F2060L probably benign Het
Rgl3 G A 9: 21,976,032 R498C probably benign Het
Rnf213 A C 11: 119,447,257 N3362H probably damaging Het
Sbds A G 5: 130,253,933 probably benign Het
Scn9a T C 2: 66,543,277 S453G probably benign Het
Sh3rf3 T C 10: 58,984,075 L236P probably damaging Het
Skint1 A G 4: 112,019,014 N44S possibly damaging Het
Trank1 T A 9: 111,391,839 I2548N probably damaging Het
Tsc22d2 G A 3: 58,417,328 probably benign Het
Unc13c T A 9: 73,933,210 I120F possibly damaging Het
Vmn2r11 T G 5: 109,059,428 I9L probably benign Het
Vmn2r58 T G 7: 41,865,204 N114H probably benign Het
Vps53 A G 11: 76,082,670 L166P probably damaging Het
Zfp119a T A 17: 55,865,248 K532* probably null Het
Zfp472 A G 17: 32,975,923 T11A possibly damaging Het
Zfp512b T A 2: 181,588,258 K87* probably null Het
Zfp518b G A 5: 38,674,575 P29L probably damaging Het
Zfp599 A G 9: 22,250,547 probably benign Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Slc5a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01573:Slc5a1 APN 5 33160865 missense probably benign
IGL01872:Slc5a1 APN 5 33154637 missense probably damaging 0.97
IGL01906:Slc5a1 APN 5 33154653 missense probably damaging 1.00
IGL02614:Slc5a1 APN 5 33154601 missense probably benign 0.02
IGL03241:Slc5a1 APN 5 33133405 missense probably benign 0.00
IGL03336:Slc5a1 APN 5 33146943 missense probably benign 0.24
R0314:Slc5a1 UTSW 5 33146651 missense probably benign 0.02
R0755:Slc5a1 UTSW 5 33133389 missense probably benign 0.14
R0791:Slc5a1 UTSW 5 33158077 splice site probably benign
R1506:Slc5a1 UTSW 5 33154708 missense possibly damaging 0.72
R1801:Slc5a1 UTSW 5 33146953 missense probably damaging 1.00
R2143:Slc5a1 UTSW 5 33160796 missense probably benign
R2190:Slc5a1 UTSW 5 33104593 critical splice donor site probably null
R3796:Slc5a1 UTSW 5 33152652 missense probably damaging 1.00
R4423:Slc5a1 UTSW 5 33154674 missense possibly damaging 0.49
R4465:Slc5a1 UTSW 5 33146516 missense possibly damaging 0.89
R4588:Slc5a1 UTSW 5 33145288 missense probably benign 0.01
R4722:Slc5a1 UTSW 5 33146711 missense possibly damaging 0.86
R4826:Slc5a1 UTSW 5 33159150 missense probably benign
R4934:Slc5a1 UTSW 5 33104514 missense probably benign
R4955:Slc5a1 UTSW 5 33160902 missense probably benign 0.02
R4963:Slc5a1 UTSW 5 33160782 missense probably benign 0.00
R5008:Slc5a1 UTSW 5 33152573 missense possibly damaging 0.75
R5094:Slc5a1 UTSW 5 33158280 missense probably damaging 1.00
R5292:Slc5a1 UTSW 5 33158241 missense probably benign
R5654:Slc5a1 UTSW 5 33146611 missense probably benign 0.00
R6784:Slc5a1 UTSW 5 33158116 missense probably benign 0.00
X0064:Slc5a1 UTSW 5 33134636 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGCCATCTGGCTACTGTGTGGAC -3'
(R):5'- AGAGCAACCTTCTGCTGACTCTCC -3'

Sequencing Primer
(F):5'- GGTTGGCGgtgtgtgtg -3'
(R):5'- GACCCCTTGGTGCATAATACAG -3'
Posted On2013-05-09