Incidental Mutation 'R0421:Atp2b2'
ID37056
Institutional Source Beutler Lab
Gene Symbol Atp2b2
Ensembl Gene ENSMUSG00000030302
Gene NameATPase, Ca++ transporting, plasma membrane 2
SynonymsPMCA2, D6Abb2e, wms, jog, Gena300, Tmy
MMRRC Submission 038623-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.835) question?
Stock #R0421 (G1)
Quality Score198
Status Validated
Chromosome6
Chromosomal Location113743831-114042613 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 113813888 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 185 (R185L)
Ref Sequence ENSEMBL: ENSMUSP00000138165 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089003] [ENSMUST00000101044] [ENSMUST00000101045] [ENSMUST00000152831] [ENSMUST00000205052]
Predicted Effect probably benign
Transcript: ENSMUST00000089003
AA Change: R185L

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000086398
Gene: ENSMUSG00000030302
AA Change: R185L

DomainStartEndE-ValueType
Cation_ATPase_N 47 123 1.21e-4 SMART
Pfam:E1-E2_ATPase 156 444 1.7e-56 PFAM
Pfam:Hydrolase 448 787 3.9e-25 PFAM
Pfam:HAD 451 784 2.4e-16 PFAM
Pfam:Hydrolase_like2 497 593 9.4e-17 PFAM
Pfam:Hydrolase_3 745 820 1.7e-6 PFAM
transmembrane domain 833 855 N/A INTRINSIC
Pfam:Cation_ATPase_C 857 1039 7.3e-46 PFAM
low complexity region 1057 1070 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1081 1144 1.4e-31 PFAM
low complexity region 1151 1166 N/A INTRINSIC
low complexity region 1175 1189 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101044
AA Change: R185L

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098605
Gene: ENSMUSG00000030302
AA Change: R185L

DomainStartEndE-ValueType
Cation_ATPase_N 47 123 1.21e-4 SMART
Pfam:E1-E2_ATPase 155 307 4.2e-28 PFAM
low complexity region 313 330 N/A INTRINSIC
low complexity region 337 356 N/A INTRINSIC
Pfam:E1-E2_ATPase 373 488 1.4e-13 PFAM
Pfam:Hydrolase 493 832 8.1e-16 PFAM
Pfam:HAD 496 829 6.3e-21 PFAM
Pfam:Cation_ATPase 542 638 4.4e-17 PFAM
Pfam:Hydrolase_3 791 865 8.3e-7 PFAM
transmembrane domain 878 900 N/A INTRINSIC
Pfam:Cation_ATPase_C 902 1084 2.5e-47 PFAM
low complexity region 1102 1115 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1126 1178 2.4e-30 PFAM
low complexity region 1196 1211 N/A INTRINSIC
low complexity region 1220 1234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101045
AA Change: R185L

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000098606
Gene: ENSMUSG00000030302
AA Change: R185L

DomainStartEndE-ValueType
Cation_ATPase_N 47 123 1.21e-4 SMART
Pfam:E1-E2_ATPase 156 444 1.7e-56 PFAM
Pfam:Hydrolase 448 787 3.9e-25 PFAM
Pfam:HAD 451 784 2.4e-16 PFAM
Pfam:Hydrolase_like2 497 593 9.4e-17 PFAM
Pfam:Hydrolase_3 745 820 1.7e-6 PFAM
transmembrane domain 833 855 N/A INTRINSIC
Pfam:Cation_ATPase_C 857 1039 7.3e-46 PFAM
low complexity region 1057 1070 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1081 1144 1.4e-31 PFAM
low complexity region 1151 1166 N/A INTRINSIC
low complexity region 1175 1189 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135199
Predicted Effect probably damaging
Transcript: ENSMUST00000152831
AA Change: R185L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138165
Gene: ENSMUSG00000030302
AA Change: R185L

DomainStartEndE-ValueType
Cation_ATPase_N 47 123 1.21e-4 SMART
Pfam:E1-E2_ATPase 156 444 6.1e-57 PFAM
Pfam:Hydrolase 448 787 1.4e-25 PFAM
Pfam:HAD 451 784 7.7e-17 PFAM
Pfam:Hydrolase_like2 497 593 4.4e-17 PFAM
Pfam:Hydrolase_3 745 820 4.2e-7 PFAM
transmembrane domain 833 855 N/A INTRINSIC
Pfam:Cation_ATPase_C 857 1039 2.7e-46 PFAM
low complexity region 1057 1070 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1081 1149 1.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000205052
AA Change: R185L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145174
Gene: ENSMUSG00000030302
AA Change: R185L

DomainStartEndE-ValueType
Cation_ATPase_N 47 123 1.21e-4 SMART
Pfam:E1-E2_ATPase 155 310 1.9e-28 PFAM
Pfam:E1-E2_ATPase 328 443 1.1e-13 PFAM
Pfam:HAD 451 780 2.7e-19 PFAM
Pfam:Cation_ATPase 497 593 5.8e-17 PFAM
Pfam:Hydrolase 576 783 2e-8 PFAM
Pfam:Hydrolase_3 711 816 2.3e-7 PFAM
transmembrane domain 829 851 N/A INTRINSIC
Pfam:Cation_ATPase_C 853 1035 2.5e-47 PFAM
low complexity region 1053 1066 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1077 1129 2.6e-30 PFAM
low complexity region 1147 1162 N/A INTRINSIC
low complexity region 1171 1185 N/A INTRINSIC
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type primary ion transport ATPases characterized by the formation of an aspartyl phosphate intermediate during the reaction cycle. These enzymes remove bivalent calcium ions from eukaryotic cells against very large concentration gradients and play a critical role in intracellular calcium homeostasis. The mammalian plasma membrane calcium ATPase isoforms are encoded by at least four separate genes and the diversity of these enzymes is further increased by alternative splicing of transcripts. The expression of different isoforms and splice variants is regulated in a developmental, tissue- and cell type-specific manner, suggesting that these pumps are functionally adapted to the physiological needs of particular cells and tissues. This gene encodes the plasma membrane calcium ATPase isoform 2. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit slower growth, balance problems, and deafness, associated with cerebellar abnormalities, an absence of otoconia, and abnormalities of the organ of Corti. Heterozygotes exhibit appreciable age-dependent hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik T C 3: 92,868,984 T131A probably damaging Het
Abi1 G A 2: 22,960,827 T195I probably damaging Het
Afap1l1 T C 18: 61,751,874 N180S probably damaging Het
Arsg A G 11: 109,527,766 Y196C probably damaging Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
Ccr9 A T 9: 123,779,606 M118L probably benign Het
Cdh12 A T 15: 21,480,224 probably null Het
Cdk13 T C 13: 17,763,170 S763G probably damaging Het
Cenpk C A 13: 104,242,403 N177K probably benign Het
Cfap43 T G 19: 47,835,575 N119T probably benign Het
Chrna6 T C 8: 27,408,387 E101G probably null Het
Clasp2 G A 9: 113,854,302 R400H probably benign Het
Col6a6 T C 9: 105,784,206 M235V probably benign Het
Ddx49 A T 8: 70,295,632 L291Q probably damaging Het
Dhrs7 A T 12: 72,653,086 probably benign Het
Dnah5 A T 15: 28,229,541 K107M possibly damaging Het
Dsg2 C T 18: 20,579,391 R151C probably damaging Het
Dsn1 T C 2: 157,005,869 T2A possibly damaging Het
Edem3 A G 1: 151,792,438 probably benign Het
Eif3c T C 7: 126,563,712 N133S possibly damaging Het
F10 A G 8: 13,045,097 K85E probably benign Het
Fam129a T A 1: 151,709,082 probably benign Het
Fam57b G A 7: 126,825,015 V44M probably damaging Het
Fbn2 T A 18: 58,027,804 probably benign Het
Gtpbp10 A T 5: 5,557,290 H50Q probably benign Het
Hephl1 A G 9: 15,059,160 F1013L probably benign Het
Hps3 C A 3: 20,029,316 V238F probably benign Het
Kcna10 A C 3: 107,194,504 K150N probably damaging Het
Kirrel C T 3: 87,083,607 G636D probably damaging Het
Kndc1 G A 7: 139,908,996 R189H probably damaging Het
Knop1 C T 7: 118,855,629 E50K possibly damaging Het
Kpna7 T A 5: 144,989,741 H467L possibly damaging Het
Lcn4 T C 2: 26,668,649 N142D possibly damaging Het
Map3k3 T C 11: 106,148,915 probably benign Het
Mdn1 A G 4: 32,684,707 T806A probably benign Het
Nbeal1 T A 1: 60,268,439 N1703K probably benign Het
Neurl4 T C 11: 69,908,534 V914A probably damaging Het
Nop56 T C 2: 130,276,772 S275P possibly damaging Het
Olfr352 A G 2: 36,869,641 E25G possibly damaging Het
Olfr655 A G 7: 104,596,722 V153A probably benign Het
Olfr868 A G 9: 20,101,475 K239E probably damaging Het
Otof A C 5: 30,371,568 I1827S possibly damaging Het
Pappa2 A T 1: 158,848,080 I1032N probably damaging Het
Pcdh7 A G 5: 57,720,060 E319G probably damaging Het
Pcdhb11 T A 18: 37,422,480 S288T probably benign Het
Phip A T 9: 82,926,457 D488E probably damaging Het
Pla2g7 A T 17: 43,611,412 H394L probably damaging Het
Plk3 A G 4: 117,133,444 V69A probably damaging Het
Prob1 C A 18: 35,653,030 A724S possibly damaging Het
Prune2 T C 19: 17,123,311 F2060L probably benign Het
Rgl3 G A 9: 21,976,032 R498C probably benign Het
Rnf213 A C 11: 119,447,257 N3362H probably damaging Het
Sbds A G 5: 130,253,933 probably benign Het
Scn9a T C 2: 66,543,277 S453G probably benign Het
Sh3rf3 T C 10: 58,984,075 L236P probably damaging Het
Skint1 A G 4: 112,019,014 N44S possibly damaging Het
Slc5a1 T A 5: 33,134,652 I141N probably damaging Het
Trank1 T A 9: 111,391,839 I2548N probably damaging Het
Tsc22d2 G A 3: 58,417,328 probably benign Het
Unc13c T A 9: 73,933,210 I120F possibly damaging Het
Vmn2r11 T G 5: 109,059,428 I9L probably benign Het
Vmn2r58 T G 7: 41,865,204 N114H probably benign Het
Vps53 A G 11: 76,082,670 L166P probably damaging Het
Zfp119a T A 17: 55,865,248 K532* probably null Het
Zfp472 A G 17: 32,975,923 T11A possibly damaging Het
Zfp512b T A 2: 181,588,258 K87* probably null Het
Zfp518b G A 5: 38,674,575 P29L probably damaging Het
Zfp599 A G 9: 22,250,547 probably benign Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Atp2b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Atp2b2 APN 6 113805515 missense possibly damaging 0.69
IGL01140:Atp2b2 APN 6 113789971 missense possibly damaging 0.94
IGL02065:Atp2b2 APN 6 113813867 missense probably damaging 1.00
IGL02267:Atp2b2 APN 6 113793730 missense probably damaging 1.00
IGL02383:Atp2b2 APN 6 113813942 missense probably damaging 0.99
IGL02498:Atp2b2 APN 6 113793854 missense probably damaging 0.99
IGL02631:Atp2b2 APN 6 113748545 missense probably damaging 1.00
IGL03028:Atp2b2 APN 6 113759142 missense probably damaging 0.99
IGL03221:Atp2b2 APN 6 113760859 splice site probably benign
IGL03290:Atp2b2 APN 6 113793754 missense probably damaging 1.00
johan UTSW 6 113773388 missense probably damaging 1.00
lohan UTSW 6 113760650 missense probably damaging 1.00
IGL02799:Atp2b2 UTSW 6 113762852 nonsense probably null
R0116:Atp2b2 UTSW 6 113793695 missense probably damaging 1.00
R0131:Atp2b2 UTSW 6 113793782 missense probably damaging 1.00
R0131:Atp2b2 UTSW 6 113793782 missense probably damaging 1.00
R0132:Atp2b2 UTSW 6 113793782 missense probably damaging 1.00
R0195:Atp2b2 UTSW 6 113793874 missense probably benign 0.07
R0791:Atp2b2 UTSW 6 113773388 missense probably damaging 1.00
R0792:Atp2b2 UTSW 6 113773388 missense probably damaging 1.00
R1033:Atp2b2 UTSW 6 113793888 splice site probably null
R1248:Atp2b2 UTSW 6 113817192 missense probably damaging 1.00
R1524:Atp2b2 UTSW 6 113774201 splice site probably benign
R1809:Atp2b2 UTSW 6 113803743 intron probably benign
R1829:Atp2b2 UTSW 6 113773368 missense probably damaging 1.00
R1854:Atp2b2 UTSW 6 113842283 missense probably damaging 1.00
R2127:Atp2b2 UTSW 6 113760650 missense probably damaging 1.00
R2138:Atp2b2 UTSW 6 113796307 missense probably benign 0.21
R2351:Atp2b2 UTSW 6 113789757 missense possibly damaging 0.91
R3923:Atp2b2 UTSW 6 113797108 critical splice donor site probably null
R3951:Atp2b2 UTSW 6 113760831 missense possibly damaging 0.51
R4178:Atp2b2 UTSW 6 113793718 missense probably damaging 1.00
R4353:Atp2b2 UTSW 6 113765784 missense probably benign 0.01
R4578:Atp2b2 UTSW 6 113760711 missense probably damaging 1.00
R4797:Atp2b2 UTSW 6 113789886 missense possibly damaging 0.92
R4884:Atp2b2 UTSW 6 113842186 missense possibly damaging 0.65
R4976:Atp2b2 UTSW 6 113759161 missense probably damaging 1.00
R5273:Atp2b2 UTSW 6 113759232 missense probably damaging 1.00
R5350:Atp2b2 UTSW 6 113759238 missense probably damaging 0.99
R5414:Atp2b2 UTSW 6 113842141 missense probably damaging 1.00
R5560:Atp2b2 UTSW 6 113774358 missense possibly damaging 0.90
R5589:Atp2b2 UTSW 6 113774439 missense possibly damaging 0.94
R5790:Atp2b2 UTSW 6 113759309 missense probably damaging 0.97
R6001:Atp2b2 UTSW 6 113793767 missense probably damaging 1.00
R6127:Atp2b2 UTSW 6 113813877 missense probably damaging 1.00
R6331:Atp2b2 UTSW 6 113797131 missense probably benign 0.01
R6925:Atp2b2 UTSW 6 113760720 missense probably damaging 1.00
R7231:Atp2b2 UTSW 6 113765732 missense possibly damaging 0.89
X0020:Atp2b2 UTSW 6 113805499 missense probably damaging 1.00
X0020:Atp2b2 UTSW 6 113805500 missense probably damaging 1.00
Z1088:Atp2b2 UTSW 6 113842306 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAACCTCCTTTGGAGCTAGTCCAC -3'
(R):5'- TTGTCTCTCTACAGGATGTGCCACGG -3'

Sequencing Primer
(F):5'- gtctcataagcccaccctg -3'
(R):5'- ATCCTGCTGTCAGTCATCTG -3'
Posted On2013-05-09