Incidental Mutation 'R0421:F10'
ID37063
Institutional Source Beutler Lab
Gene Symbol F10
Ensembl Gene ENSMUSG00000031444
Gene Namecoagulation factor X
SynonymsAI194738, Cf10, fX
MMRRC Submission 038623-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0421 (G1)
Quality Score118
Status Not validated
Chromosome8
Chromosomal Location13037308-13056676 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13045097 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 85 (K85E)
Ref Sequence ENSEMBL: ENSMUSP00000117312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033821] [ENSMUST00000063820] [ENSMUST00000123768] [ENSMUST00000128418] [ENSMUST00000152034]
Predicted Effect probably benign
Transcript: ENSMUST00000033821
AA Change: K97E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000033821
Gene: ENSMUSG00000031444
AA Change: K97E

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
GLA 34 97 5.98e-32 SMART
EGF_CA 98 134 4.56e-9 SMART
EGF 140 177 2.66e-1 SMART
low complexity region 201 218 N/A INTRINSIC
Tryp_SPc 243 471 9.03e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063820
AA Change: K85E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000068389
Gene: ENSMUSG00000031444
AA Change: K85E

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
GLA 22 85 5.98e-32 SMART
EGF_CA 86 122 4.56e-9 SMART
EGF 128 165 2.66e-1 SMART
low complexity region 189 206 N/A INTRINSIC
Tryp_SPc 231 459 9.03e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123768
AA Change: K85E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000116984
Gene: ENSMUSG00000031444
AA Change: K85E

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
GLA 22 85 5.98e-32 SMART
EGF 89 119 2.25e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128418
AA Change: K85E

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000121830
Gene: ENSMUSG00000031444
AA Change: K85E

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
GLA 22 85 5.98e-32 SMART
EGF_CA 86 122 4.56e-9 SMART
EGF 128 165 2.66e-1 SMART
low complexity region 189 206 N/A INTRINSIC
Pfam:Trypsin 232 298 4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152034
AA Change: K85E

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000117312
Gene: ENSMUSG00000031444
AA Change: K85E

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
GLA 22 85 5.98e-32 SMART
EGF_CA 86 122 4.56e-9 SMART
EGF 128 165 2.66e-1 SMART
low complexity region 189 206 N/A INTRINSIC
Pfam:Trypsin 232 297 1.1e-15 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: This gene encodes factor X, a component of both the intrinsic and extrinsic blood coagulation pathways. The encoded protein is a zymogen that undergoes further processing in a vitamin K-dependent manner to generate mature factor X, a heterodimer comprised of disulfide-linked heavy and light chains. The mature factor X is proteolytically activated either by factor IXa (intrinsic pathway) or factor VIIa (extrinsic pathway) to form factor Xa serine endopeptidase. Activated factor Xa catalyzes the conversion of prothrombin to thrombin. A complete lack of the encoded protein is fatal to mice. A severe deficiency of the encoded protein in mice causes age-dependent iron deposition and cardiac fibrosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Most homozygous mice die from fatal bleeding events at embryonic and neonatal stages, with the remaining homozygous mice dying before weaning stages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik T C 3: 92,868,984 T131A probably damaging Het
Abi1 G A 2: 22,960,827 T195I probably damaging Het
Afap1l1 T C 18: 61,751,874 N180S probably damaging Het
Arsg A G 11: 109,527,766 Y196C probably damaging Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
Atp2b2 C A 6: 113,813,888 R185L probably damaging Het
Ccr9 A T 9: 123,779,606 M118L probably benign Het
Cdh12 A T 15: 21,480,224 probably null Het
Cdk13 T C 13: 17,763,170 S763G probably damaging Het
Cenpk C A 13: 104,242,403 N177K probably benign Het
Cfap43 T G 19: 47,835,575 N119T probably benign Het
Chrna6 T C 8: 27,408,387 E101G probably null Het
Clasp2 G A 9: 113,854,302 R400H probably benign Het
Col6a6 T C 9: 105,784,206 M235V probably benign Het
Ddx49 A T 8: 70,295,632 L291Q probably damaging Het
Dhrs7 A T 12: 72,653,086 probably benign Het
Dnah5 A T 15: 28,229,541 K107M possibly damaging Het
Dsg2 C T 18: 20,579,391 R151C probably damaging Het
Dsn1 T C 2: 157,005,869 T2A possibly damaging Het
Edem3 A G 1: 151,792,438 probably benign Het
Eif3c T C 7: 126,563,712 N133S possibly damaging Het
Fam129a T A 1: 151,709,082 probably benign Het
Fam57b G A 7: 126,825,015 V44M probably damaging Het
Fbn2 T A 18: 58,027,804 probably benign Het
Gtpbp10 A T 5: 5,557,290 H50Q probably benign Het
Hephl1 A G 9: 15,059,160 F1013L probably benign Het
Hps3 C A 3: 20,029,316 V238F probably benign Het
Kcna10 A C 3: 107,194,504 K150N probably damaging Het
Kirrel C T 3: 87,083,607 G636D probably damaging Het
Kndc1 G A 7: 139,908,996 R189H probably damaging Het
Knop1 C T 7: 118,855,629 E50K possibly damaging Het
Kpna7 T A 5: 144,989,741 H467L possibly damaging Het
Lcn4 T C 2: 26,668,649 N142D possibly damaging Het
Map3k3 T C 11: 106,148,915 probably benign Het
Mdn1 A G 4: 32,684,707 T806A probably benign Het
Nbeal1 T A 1: 60,268,439 N1703K probably benign Het
Neurl4 T C 11: 69,908,534 V914A probably damaging Het
Nop56 T C 2: 130,276,772 S275P possibly damaging Het
Olfr352 A G 2: 36,869,641 E25G possibly damaging Het
Olfr655 A G 7: 104,596,722 V153A probably benign Het
Olfr868 A G 9: 20,101,475 K239E probably damaging Het
Otof A C 5: 30,371,568 I1827S possibly damaging Het
Pappa2 A T 1: 158,848,080 I1032N probably damaging Het
Pcdh7 A G 5: 57,720,060 E319G probably damaging Het
Pcdhb11 T A 18: 37,422,480 S288T probably benign Het
Phip A T 9: 82,926,457 D488E probably damaging Het
Pla2g7 A T 17: 43,611,412 H394L probably damaging Het
Plk3 A G 4: 117,133,444 V69A probably damaging Het
Prob1 C A 18: 35,653,030 A724S possibly damaging Het
Prune2 T C 19: 17,123,311 F2060L probably benign Het
Rgl3 G A 9: 21,976,032 R498C probably benign Het
Rnf213 A C 11: 119,447,257 N3362H probably damaging Het
Sbds A G 5: 130,253,933 probably benign Het
Scn9a T C 2: 66,543,277 S453G probably benign Het
Sh3rf3 T C 10: 58,984,075 L236P probably damaging Het
Skint1 A G 4: 112,019,014 N44S possibly damaging Het
Slc5a1 T A 5: 33,134,652 I141N probably damaging Het
Trank1 T A 9: 111,391,839 I2548N probably damaging Het
Tsc22d2 G A 3: 58,417,328 probably benign Het
Unc13c T A 9: 73,933,210 I120F possibly damaging Het
Vmn2r11 T G 5: 109,059,428 I9L probably benign Het
Vmn2r58 T G 7: 41,865,204 N114H probably benign Het
Vps53 A G 11: 76,082,670 L166P probably damaging Het
Zfp119a T A 17: 55,865,248 K532* probably null Het
Zfp472 A G 17: 32,975,923 T11A possibly damaging Het
Zfp512b T A 2: 181,588,258 K87* probably null Het
Zfp518b G A 5: 38,674,575 P29L probably damaging Het
Zfp599 A G 9: 22,250,547 probably benign Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in F10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01104:F10 APN 8 13055686 missense probably damaging 1.00
IGL01296:F10 APN 8 13055383 missense possibly damaging 0.49
IGL02010:F10 APN 8 13048292 missense probably damaging 0.97
IGL02707:F10 APN 8 13048252 missense probably damaging 1.00
IGL02716:F10 APN 8 13048177 nonsense probably null
IGL03354:F10 APN 8 13045089 missense probably benign 0.00
ju UTSW 8 13055698 missense probably damaging 1.00
PIT4494001:F10 UTSW 8 13053423 missense probably damaging 1.00
R0243:F10 UTSW 8 13048196 missense probably damaging 1.00
R0321:F10 UTSW 8 13053413 missense possibly damaging 0.95
R0416:F10 UTSW 8 13055448 missense probably damaging 1.00
R0545:F10 UTSW 8 13048249 missense probably damaging 1.00
R1630:F10 UTSW 8 13055551 missense probably benign 0.00
R1732:F10 UTSW 8 13050764 missense probably damaging 1.00
R1956:F10 UTSW 8 13055422 missense probably damaging 1.00
R4130:F10 UTSW 8 13055584 missense possibly damaging 0.94
R4700:F10 UTSW 8 13039621 missense possibly damaging 0.93
R4989:F10 UTSW 8 13055698 missense probably damaging 1.00
R5133:F10 UTSW 8 13055698 missense probably damaging 1.00
R5134:F10 UTSW 8 13055698 missense probably damaging 1.00
R6826:F10 UTSW 8 13046165 splice site probably null
X0024:F10 UTSW 8 13055859 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGCAAGAGCCATGTGTTGAAGC -3'
(R):5'- GTGCTATGAGGGTGACTTGAACCTG -3'

Sequencing Primer
(F):5'- AGCCATGTGTTGAAGCAGATTG -3'
(R):5'- CCTGGGGTTTTGCAGCAAC -3'
Posted On2013-05-09