Incidental Mutation 'R4806:Mdga1'
ID370708
Institutional Source Beutler Lab
Gene Symbol Mdga1
Ensembl Gene ENSMUSG00000043557
Gene NameMAM domain containing glycosylphosphatidylinositol anchor 1
Synonyms
MMRRC Submission 042425-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.290) question?
Stock #R4806 (G1)
Quality Score134
Status Validated
Chromosome17
Chromosomal Location29827956-29970087 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29842154 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 621 (D621G)
Ref Sequence ENSEMBL: ENSMUSP00000126529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073556] [ENSMUST00000167190] [ENSMUST00000168044] [ENSMUST00000171691]
Predicted Effect probably benign
Transcript: ENSMUST00000073556
AA Change: D621G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000073246
Gene: ENSMUSG00000043557
AA Change: D621G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 51 115 1.62e-12 SMART
IG 142 236 3.2e-2 SMART
IGc2 253 315 6.25e-14 SMART
IGc2 348 422 3.54e-4 SMART
IGc2 454 521 6.55e-8 SMART
IGc2 551 623 9.49e-5 SMART
FN3 642 731 2.05e0 SMART
MAM 741 911 1.02e-52 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165528
Predicted Effect probably benign
Transcript: ENSMUST00000167190
AA Change: D895G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000130395
Gene: ENSMUSG00000043557
AA Change: D895G

DomainStartEndE-ValueType
low complexity region 236 246 N/A INTRINSIC
low complexity region 251 265 N/A INTRINSIC
IGc2 325 389 1.62e-12 SMART
IG 416 510 3.2e-2 SMART
IGc2 527 589 6.25e-14 SMART
IGc2 622 696 3.54e-4 SMART
IGc2 728 795 6.55e-8 SMART
IGc2 825 897 9.49e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168044
SMART Domains Protein: ENSMUSP00000126571
Gene: ENSMUSG00000043557

DomainStartEndE-ValueType
Pfam:MAM 47 186 3.1e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171691
AA Change: D621G

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000126529
Gene: ENSMUSG00000043557
AA Change: D621G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 51 115 1.62e-12 SMART
IG 142 236 3.2e-2 SMART
IGc2 253 315 6.25e-14 SMART
IGc2 348 422 3.54e-4 SMART
IGc2 454 521 6.55e-8 SMART
IGc2 551 623 9.49e-5 SMART
FN3 642 731 2.05e0 SMART
MAM 749 919 3.61e-53 SMART
Meta Mutation Damage Score 0.046 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosylphosphatidylinositol (GPI)-anchored cell surface glycoprotein that is expressed predominantly in the developing nervous system. In addition to possessing several cell adhesion molecule-like domains, the mature protein has six Ig-like domains, a single fibronectin type III domain, a MAM domain and a C-terminal GPI-anchoring site. Studies in other mammals suggest this protein plays a role in cell adhesion, migration, and axon guidance and, in the developing brain, neuronal migration. In humans, this gene is associated with bipolar disorder and schizophrenia. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuronal migration during corticogenesis that is resolved by P7 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik A G 7: 27,565,645 probably null Het
2410137M14Rik T A 17: 36,978,854 H28L probably benign Het
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
Acd A G 8: 105,698,290 V406A possibly damaging Het
Acin1 A T 14: 54,679,228 probably benign Het
Agbl4 T C 4: 110,955,637 V118A probably damaging Het
Arhgap5 A G 12: 52,518,703 D819G probably damaging Het
BC049715 A T 6: 136,839,929 I56F possibly damaging Het
C1rb A T 6: 124,574,949 Q270L probably benign Het
Cadps2 C T 6: 23,688,860 R121Q probably damaging Het
Cd84 A G 1: 171,852,121 Y122C probably benign Het
Cklf C A 8: 104,257,435 P77T probably damaging Het
Clrn2 T C 5: 45,454,004 L65P probably damaging Het
Csde1 TCCTCGACCT TCCT 3: 103,056,369 probably benign Het
Csf2rb2 T C 15: 78,285,290 D446G probably benign Het
Csmd3 T C 15: 48,314,068 E358G probably benign Het
Dmkn C T 7: 30,771,242 T385I possibly damaging Het
Dnah10 A G 5: 124,819,344 T3591A probably damaging Het
Dpp9 A G 17: 56,190,030 L734P probably damaging Het
Edem2 A G 2: 155,728,993 V39A possibly damaging Het
Glmp A C 3: 88,326,013 probably benign Het
Gm20775 T C Y: 10,641,885 noncoding transcript Het
Gpr179 T G 11: 97,349,784 D271A possibly damaging Het
Gtf2ird1 A G 5: 134,383,896 V587A probably damaging Het
Igfn1 T A 1: 135,967,357 T1824S probably benign Het
Ighmbp2 A T 19: 3,261,589 I942N probably damaging Het
Ints2 A G 11: 86,256,209 L37P probably benign Het
Irgq T A 7: 24,534,045 L437Q probably damaging Het
Kcnq4 A T 4: 120,713,094 W351R probably damaging Het
Kif3b G A 2: 153,320,368 A500T probably damaging Het
Lpp A G 16: 24,661,680 D66G probably damaging Het
Mapkap1 G A 2: 34,597,422 probably null Het
Mc4r T A 18: 66,859,488 I185F probably damaging Het
Med13 A G 11: 86,298,577 S1169P probably benign Het
Myh11 A T 16: 14,201,083 probably null Het
Naip1 G A 13: 100,425,621 A1012V probably benign Het
Ntn4 C T 10: 93,644,500 R29C probably damaging Het
Plb1 G A 5: 32,289,852 G321D probably damaging Het
Plxnd1 A G 6: 115,960,855 V1510A probably damaging Het
Polr1e T A 4: 45,024,482 M131K probably benign Het
Prdm10 T A 9: 31,329,941 *342R probably null Het
Prex2 T C 1: 11,068,020 F108L probably damaging Het
Psmg2 T A 18: 67,648,922 I186N probably benign Het
Ros1 T A 10: 52,096,175 E1614D probably damaging Het
Sin3a G A 9: 57,086,742 V44M probably damaging Het
Slco1a1 G A 6: 141,909,009 L639F possibly damaging Het
Smr2 T G 5: 88,098,430 L101* probably null Het
Spata31d1b C T 13: 59,715,721 P228S probably benign Het
Stat5b G T 11: 100,790,797 H544N probably benign Het
Syk A T 13: 52,632,927 Y319F probably benign Het
Tln2 G T 9: 67,331,733 T1087K probably benign Het
Tsc22d1 A G 14: 76,416,988 probably null Het
Vmn2r52 T A 7: 10,159,242 T657S probably damaging Het
Vmn2r63 A T 7: 42,926,890 S500T probably benign Het
Vps45 A C 3: 96,046,413 V209G probably benign Het
Xrcc1 C A 7: 24,570,480 A442E probably benign Het
Ythdc1 T A 5: 86,822,845 V430E probably damaging Het
Zfp341 G A 2: 154,645,866 probably benign Het
Zfp422 A T 6: 116,626,662 N125K probably damaging Het
Zfp53 T A 17: 21,505,001 D58E possibly damaging Het
Zfp707 C T 15: 75,973,151 Q66* probably null Het
Other mutations in Mdga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01576:Mdga1 APN 17 29843127 missense possibly damaging 0.50
IGL01637:Mdga1 APN 17 29839871 missense probably damaging 1.00
IGL02130:Mdga1 APN 17 29857669 missense possibly damaging 0.96
IGL02596:Mdga1 APN 17 29832405 splice site probably benign
IGL03258:Mdga1 APN 17 29839913 missense probably damaging 1.00
R0184:Mdga1 UTSW 17 29852442 missense probably damaging 1.00
R0366:Mdga1 UTSW 17 29857708 missense possibly damaging 0.85
R1017:Mdga1 UTSW 17 29850548 missense probably damaging 0.98
R1520:Mdga1 UTSW 17 29846519 missense probably benign 0.12
R1545:Mdga1 UTSW 17 29842902 missense probably damaging 1.00
R1549:Mdga1 UTSW 17 29837998 missense probably damaging 1.00
R1671:Mdga1 UTSW 17 29850629 missense probably damaging 1.00
R1875:Mdga1 UTSW 17 29852607 missense probably damaging 1.00
R1893:Mdga1 UTSW 17 29849226 missense probably damaging 1.00
R1958:Mdga1 UTSW 17 29840888 missense probably damaging 1.00
R1983:Mdga1 UTSW 17 29850605 missense probably damaging 1.00
R2014:Mdga1 UTSW 17 29849313 missense probably damaging 1.00
R2894:Mdga1 UTSW 17 29852504 missense probably damaging 1.00
R2964:Mdga1 UTSW 17 29852468 missense probably damaging 1.00
R3813:Mdga1 UTSW 17 29838479 missense probably damaging 1.00
R3938:Mdga1 UTSW 17 29857622 missense probably damaging 1.00
R3982:Mdga1 UTSW 17 29931264 missense unknown
R4063:Mdga1 UTSW 17 29838031 missense probably damaging 1.00
R4157:Mdga1 UTSW 17 29833343 missense probably benign 0.32
R4183:Mdga1 UTSW 17 29969990 missense unknown
R4392:Mdga1 UTSW 17 29850656 missense probably damaging 1.00
R4393:Mdga1 UTSW 17 29850517 missense probably damaging 1.00
R4396:Mdga1 UTSW 17 29850517 missense probably damaging 1.00
R4829:Mdga1 UTSW 17 29846369 missense possibly damaging 0.91
R4923:Mdga1 UTSW 17 29838078 missense probably damaging 0.99
R4932:Mdga1 UTSW 17 29857606 missense probably damaging 1.00
R5015:Mdga1 UTSW 17 29839873 missense possibly damaging 0.71
R5076:Mdga1 UTSW 17 29850554 missense possibly damaging 0.93
R5141:Mdga1 UTSW 17 29852493 missense probably benign 0.43
R5180:Mdga1 UTSW 17 29857736 splice site probably benign
R5590:Mdga1 UTSW 17 29839867 missense probably damaging 1.00
R5747:Mdga1 UTSW 17 29850551 missense probably benign 0.11
R5748:Mdga1 UTSW 17 29850551 missense probably benign 0.11
R6207:Mdga1 UTSW 17 29838517 missense probably damaging 1.00
R6826:Mdga1 UTSW 17 29970026 missense unknown
R6831:Mdga1 UTSW 17 29887516 nonsense probably null
R7147:Mdga1 UTSW 17 29846521 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTAAAGACTGCAGGAGCTAG -3'
(R):5'- ATGGTCCTACTGACGGTAGTC -3'

Sequencing Primer
(F):5'- CTAGAAGGAAAGAGCAGCCC -3'
(R):5'- AGAGGTGGAGCCCAGTTC -3'
Posted On2016-02-04