Incidental Mutation 'R0421:Neurl4'
ID37078
Institutional Source Beutler Lab
Gene Symbol Neurl4
Ensembl Gene ENSMUSG00000047284
Gene Nameneuralized E3 ubiquitin protein ligase 4
Synonyms0610025P10Rik
MMRRC Submission 038623-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0421 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69901072-69913820 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69908534 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 914 (V914A)
Ref Sequence ENSEMBL: ENSMUSP00000104257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061837] [ENSMUST00000108617] [ENSMUST00000129475] [ENSMUST00000133203] [ENSMUST00000177138] [ENSMUST00000177476]
Predicted Effect probably benign
Transcript: ENSMUST00000061837
AA Change: V936A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000053235
Gene: ENSMUSG00000047284
AA Change: V936A

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 317 442 7.22e-52 SMART
low complexity region 492 503 N/A INTRINSIC
NEUZ 520 644 6.15e-46 SMART
low complexity region 686 700 N/A INTRINSIC
NEUZ 716 840 7.81e-39 SMART
NEUZ 913 1043 2.27e-17 SMART
low complexity region 1108 1117 N/A INTRINSIC
NEUZ 1130 1250 4.93e-6 SMART
low complexity region 1453 1464 N/A INTRINSIC
low complexity region 1474 1483 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108617
AA Change: V914A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104257
Gene: ENSMUSG00000047284
AA Change: V914A

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 3.5e-31 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 295 420 2.5e-54 SMART
low complexity region 470 481 N/A INTRINSIC
NEUZ 498 622 2e-48 SMART
low complexity region 664 678 N/A INTRINSIC
NEUZ 694 818 2.6e-41 SMART
NEUZ 891 1021 7.6e-20 SMART
low complexity region 1086 1095 N/A INTRINSIC
NEUZ 1108 1228 1.7e-8 SMART
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1452 1461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129475
SMART Domains Protein: ENSMUSP00000135733
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
NEUZ 1 119 4.22e-44 SMART
low complexity region 169 180 N/A INTRINSIC
low complexity region 182 201 N/A INTRINSIC
internal_repeat_1 206 246 1.46e-10 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000132183
SMART Domains Protein: ENSMUSP00000118868
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
low complexity region 161 172 N/A INTRINSIC
low complexity region 182 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133203
AA Change: V679A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117917
Gene: ENSMUSG00000047284
AA Change: V679A

DomainStartEndE-ValueType
NEUZ 60 185 7.22e-52 SMART
low complexity region 235 246 N/A INTRINSIC
NEUZ 263 387 6.15e-46 SMART
low complexity region 429 443 N/A INTRINSIC
NEUZ 459 583 7.81e-39 SMART
NEUZ 656 786 2.27e-17 SMART
low complexity region 851 860 N/A INTRINSIC
Pfam:Neuralized 875 942 6.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143861
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175761
Predicted Effect probably benign
Transcript: ENSMUST00000177138
AA Change: V912A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000135277
Gene: ENSMUSG00000047284
AA Change: V912A

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 295 420 7.22e-52 SMART
low complexity region 470 481 N/A INTRINSIC
NEUZ 498 622 6.15e-46 SMART
low complexity region 664 678 N/A INTRINSIC
NEUZ 694 818 7.81e-39 SMART
NEUZ 889 1019 2.27e-17 SMART
low complexity region 1084 1093 N/A INTRINSIC
NEUZ 1106 1226 4.93e-6 SMART
low complexity region 1429 1440 N/A INTRINSIC
low complexity region 1450 1459 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177160
Predicted Effect probably benign
Transcript: ENSMUST00000177476
AA Change: V934A

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000135185
Gene: ENSMUSG00000047284
AA Change: V934A

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 317 442 7.22e-52 SMART
low complexity region 492 503 N/A INTRINSIC
NEUZ 520 644 6.15e-46 SMART
low complexity region 686 700 N/A INTRINSIC
NEUZ 716 840 7.81e-39 SMART
NEUZ 911 1041 2.27e-17 SMART
low complexity region 1106 1115 N/A INTRINSIC
NEUZ 1128 1248 4.93e-6 SMART
low complexity region 1451 1462 N/A INTRINSIC
low complexity region 1472 1481 N/A INTRINSIC
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted and it includes two isoforms resulting from two alternatively spliced transcript variants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik T C 3: 92,868,984 T131A probably damaging Het
Abi1 G A 2: 22,960,827 T195I probably damaging Het
Afap1l1 T C 18: 61,751,874 N180S probably damaging Het
Arsg A G 11: 109,527,766 Y196C probably damaging Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
Atp2b2 C A 6: 113,813,888 R185L probably damaging Het
Ccr9 A T 9: 123,779,606 M118L probably benign Het
Cdh12 A T 15: 21,480,224 probably null Het
Cdk13 T C 13: 17,763,170 S763G probably damaging Het
Cenpk C A 13: 104,242,403 N177K probably benign Het
Cfap43 T G 19: 47,835,575 N119T probably benign Het
Chrna6 T C 8: 27,408,387 E101G probably null Het
Clasp2 G A 9: 113,854,302 R400H probably benign Het
Col6a6 T C 9: 105,784,206 M235V probably benign Het
Ddx49 A T 8: 70,295,632 L291Q probably damaging Het
Dhrs7 A T 12: 72,653,086 probably benign Het
Dnah5 A T 15: 28,229,541 K107M possibly damaging Het
Dsg2 C T 18: 20,579,391 R151C probably damaging Het
Dsn1 T C 2: 157,005,869 T2A possibly damaging Het
Edem3 A G 1: 151,792,438 probably benign Het
Eif3c T C 7: 126,563,712 N133S possibly damaging Het
F10 A G 8: 13,045,097 K85E probably benign Het
Fam129a T A 1: 151,709,082 probably benign Het
Fam57b G A 7: 126,825,015 V44M probably damaging Het
Fbn2 T A 18: 58,027,804 probably benign Het
Gtpbp10 A T 5: 5,557,290 H50Q probably benign Het
Hephl1 A G 9: 15,059,160 F1013L probably benign Het
Hps3 C A 3: 20,029,316 V238F probably benign Het
Kcna10 A C 3: 107,194,504 K150N probably damaging Het
Kirrel C T 3: 87,083,607 G636D probably damaging Het
Kndc1 G A 7: 139,908,996 R189H probably damaging Het
Knop1 C T 7: 118,855,629 E50K possibly damaging Het
Kpna7 T A 5: 144,989,741 H467L possibly damaging Het
Lcn4 T C 2: 26,668,649 N142D possibly damaging Het
Map3k3 T C 11: 106,148,915 probably benign Het
Mdn1 A G 4: 32,684,707 T806A probably benign Het
Nbeal1 T A 1: 60,268,439 N1703K probably benign Het
Nop56 T C 2: 130,276,772 S275P possibly damaging Het
Olfr352 A G 2: 36,869,641 E25G possibly damaging Het
Olfr655 A G 7: 104,596,722 V153A probably benign Het
Olfr868 A G 9: 20,101,475 K239E probably damaging Het
Otof A C 5: 30,371,568 I1827S possibly damaging Het
Pappa2 A T 1: 158,848,080 I1032N probably damaging Het
Pcdh7 A G 5: 57,720,060 E319G probably damaging Het
Pcdhb11 T A 18: 37,422,480 S288T probably benign Het
Phip A T 9: 82,926,457 D488E probably damaging Het
Pla2g7 A T 17: 43,611,412 H394L probably damaging Het
Plk3 A G 4: 117,133,444 V69A probably damaging Het
Prob1 C A 18: 35,653,030 A724S possibly damaging Het
Prune2 T C 19: 17,123,311 F2060L probably benign Het
Rgl3 G A 9: 21,976,032 R498C probably benign Het
Rnf213 A C 11: 119,447,257 N3362H probably damaging Het
Sbds A G 5: 130,253,933 probably benign Het
Scn9a T C 2: 66,543,277 S453G probably benign Het
Sh3rf3 T C 10: 58,984,075 L236P probably damaging Het
Skint1 A G 4: 112,019,014 N44S possibly damaging Het
Slc5a1 T A 5: 33,134,652 I141N probably damaging Het
Trank1 T A 9: 111,391,839 I2548N probably damaging Het
Tsc22d2 G A 3: 58,417,328 probably benign Het
Unc13c T A 9: 73,933,210 I120F possibly damaging Het
Vmn2r11 T G 5: 109,059,428 I9L probably benign Het
Vmn2r58 T G 7: 41,865,204 N114H probably benign Het
Vps53 A G 11: 76,082,670 L166P probably damaging Het
Zfp119a T A 17: 55,865,248 K532* probably null Het
Zfp472 A G 17: 32,975,923 T11A possibly damaging Het
Zfp512b T A 2: 181,588,258 K87* probably null Het
Zfp518b G A 5: 38,674,575 P29L probably damaging Het
Zfp599 A G 9: 22,250,547 probably benign Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Neurl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Neurl4 APN 11 69904587 missense probably damaging 1.00
IGL00516:Neurl4 APN 11 69910393 missense probably damaging 0.98
IGL01409:Neurl4 APN 11 69907099 missense probably damaging 1.00
IGL01951:Neurl4 APN 11 69909623 missense probably damaging 1.00
IGL02056:Neurl4 APN 11 69905790 missense probably damaging 1.00
IGL02206:Neurl4 APN 11 69910340 missense probably damaging 1.00
IGL02557:Neurl4 APN 11 69906335 missense probably damaging 1.00
IGL02878:Neurl4 APN 11 69906831 missense probably damaging 1.00
P0022:Neurl4 UTSW 11 69909065 missense possibly damaging 0.86
PIT4377001:Neurl4 UTSW 11 69910406 missense probably benign 0.41
R0388:Neurl4 UTSW 11 69911733 splice site probably benign
R0449:Neurl4 UTSW 11 69905567 missense probably damaging 0.99
R1174:Neurl4 UTSW 11 69903721 critical splice donor site probably null
R1345:Neurl4 UTSW 11 69903876 missense probably benign 0.21
R1536:Neurl4 UTSW 11 69903426 nonsense probably null
R1642:Neurl4 UTSW 11 69903659 missense probably benign 0.03
R1857:Neurl4 UTSW 11 69905535 missense probably damaging 1.00
R1935:Neurl4 UTSW 11 69907133 missense probably damaging 1.00
R1936:Neurl4 UTSW 11 69907133 missense probably damaging 1.00
R1967:Neurl4 UTSW 11 69903210 missense possibly damaging 0.90
R1973:Neurl4 UTSW 11 69909292 missense probably benign
R2046:Neurl4 UTSW 11 69908697 missense probably damaging 1.00
R2165:Neurl4 UTSW 11 69903221 missense probably benign
R2393:Neurl4 UTSW 11 69907074 missense probably damaging 1.00
R3810:Neurl4 UTSW 11 69904033 missense probably damaging 1.00
R4299:Neurl4 UTSW 11 69909061 missense probably damaging 1.00
R4749:Neurl4 UTSW 11 69911068 missense probably benign 0.00
R4898:Neurl4 UTSW 11 69903171 missense probably damaging 0.99
R4968:Neurl4 UTSW 11 69907308 missense probably damaging 1.00
R4969:Neurl4 UTSW 11 69911087 missense probably damaging 1.00
R5503:Neurl4 UTSW 11 69906368 missense probably damaging 1.00
R6655:Neurl4 UTSW 11 69910916 critical splice donor site probably null
R6791:Neurl4 UTSW 11 69908510 missense probably damaging 1.00
R7029:Neurl4 UTSW 11 69910736 missense probably damaging 0.99
R7216:Neurl4 UTSW 11 69910262 missense probably damaging 1.00
X0025:Neurl4 UTSW 11 69906801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAAGTCATTCCCCTTGCATTCCC -3'
(R):5'- ACACCATCCAGGTGGTCTTTGTCC -3'

Sequencing Primer
(F):5'- CCCCAGGTATTGCTTAAGGAG -3'
(R):5'- CCATGTCCTCTGGTGCAAG -3'
Posted On2013-05-09