Incidental Mutation 'R4807:Ddx24'
ID370784
Institutional Source Beutler Lab
Gene Symbol Ddx24
Ensembl Gene ENSMUSG00000041645
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 24
Synonyms2510027P10Rik, 1700055J08Rik
MMRRC Submission 042426-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4807 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location103407982-103425830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103419461 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 248 (F248L)
Ref Sequence ENSEMBL: ENSMUSP00000040890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044923] [ENSMUST00000110001] [ENSMUST00000220975] [ENSMUST00000221211] [ENSMUST00000223233]
Predicted Effect probably damaging
Transcript: ENSMUST00000044923
AA Change: F248L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000040890
Gene: ENSMUSG00000041645
AA Change: F248L

DomainStartEndE-ValueType
low complexity region 94 101 N/A INTRINSIC
low complexity region 105 114 N/A INTRINSIC
low complexity region 154 162 N/A INTRINSIC
low complexity region 168 180 N/A INTRINSIC
DEXDc 212 541 1.14e-39 SMART
HELICc 601 682 5.22e-25 SMART
low complexity region 752 766 N/A INTRINSIC
low complexity region 775 787 N/A INTRINSIC
low complexity region 835 852 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110001
AA Change: F294L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105628
Gene: ENSMUSG00000041645
AA Change: F294L

DomainStartEndE-ValueType
low complexity region 140 147 N/A INTRINSIC
low complexity region 151 160 N/A INTRINSIC
low complexity region 200 208 N/A INTRINSIC
low complexity region 214 226 N/A INTRINSIC
DEXDc 258 587 1.14e-39 SMART
HELICc 647 728 5.22e-25 SMART
low complexity region 798 812 N/A INTRINSIC
low complexity region 821 833 N/A INTRINSIC
low complexity region 881 898 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220705
Predicted Effect probably benign
Transcript: ENSMUST00000220975
Predicted Effect probably damaging
Transcript: ENSMUST00000221211
AA Change: F248L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221358
Predicted Effect probably benign
Transcript: ENSMUST00000222782
Predicted Effect probably benign
Transcript: ENSMUST00000223233
Meta Mutation Damage Score 0.516 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which shows little similarity to any of the other known human DEAD box proteins, but shows a high similarity to mouse Ddx24 at the amino acid level. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout is embryonic lethal: embryos die between implantation and placentation. Heterozygous KO animals are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 C T 7: 120,540,609 A1499V probably damaging Het
Agap3 T A 5: 24,477,116 D386E probably damaging Het
Ahdc1 C A 4: 133,064,313 T955K possibly damaging Het
Ankrd9 A G 12: 110,977,235 Y122H probably benign Het
Apc2 G T 10: 80,314,362 R1721L probably benign Het
Arfgef3 A G 10: 18,646,637 V547A probably benign Het
Arhgap42 T C 9: 9,046,628 N203D possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Aspm T A 1: 139,477,919 F1515I probably damaging Het
Baz1a T C 12: 54,898,482 T1363A probably benign Het
Cacng3 C T 7: 122,754,509 A72V probably benign Het
Casp8ap2 T C 4: 32,644,505 C1193R possibly damaging Het
Ccr3 A G 9: 124,029,297 Y223C probably damaging Het
Clcn3 C A 8: 60,934,530 L201F probably damaging Het
Cltc A C 11: 86,701,076 probably benign Het
Cyp19a1 G T 9: 54,176,646 T86K possibly damaging Het
Ddx60 G A 8: 61,979,338 V885I probably damaging Het
Dync2h1 T C 9: 7,139,422 I1404M probably benign Het
Emilin2 A T 17: 71,273,448 V761E probably damaging Het
Endou C T 15: 97,731,232 C13Y probably benign Het
Ep400 C A 5: 110,695,578 probably null Het
Fbxo33 C A 12: 59,219,212 D90Y probably damaging Het
Fryl A G 5: 73,041,362 F2641L probably benign Het
Gbp2b A G 3: 142,598,245 I34V probably benign Het
Ghdc T C 11: 100,770,225 H38R probably damaging Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gpr63 A C 4: 25,007,446 M57L probably benign Het
Gprc5c A G 11: 114,864,498 S3G probably damaging Het
Grk4 A T 5: 34,752,208 M539L probably benign Het
Gulo C T 14: 65,990,384 M366I probably benign Het
Heatr5a T C 12: 51,877,520 H1970R probably damaging Het
Hmbox1 T C 14: 64,825,549 probably benign Het
Ighg2b T C 12: 113,304,345 probably benign Het
Il1b A T 2: 129,370,306 C9S probably benign Het
Itpkb A T 1: 180,334,875 probably benign Het
Kcnn1 T A 8: 70,848,178 H473L probably damaging Het
Kidins220 C T 12: 25,057,285 S1579L probably damaging Het
Kif1b A T 4: 149,247,921 probably benign Het
Lyg2 A T 1: 37,911,067 M60K possibly damaging Het
Mak16 G T 8: 31,166,133 H107Q probably benign Het
Mapkap1 G A 2: 34,597,422 probably null Het
Mastl A G 2: 23,132,843 S623P probably benign Het
Mccc1 T C 3: 35,985,046 Y46C probably damaging Het
Mdn1 T G 4: 32,685,651 probably null Het
Med25 T A 7: 44,884,619 T31S probably benign Het
Mprip G A 11: 59,758,020 G850D probably benign Het
Mrpl10 T C 11: 97,041,623 I8T probably benign Het
Msr1 T C 8: 39,642,627 probably benign Het
Myo3b T A 2: 70,105,712 I99N probably damaging Het
Neurod6 A T 6: 55,678,655 N332K probably damaging Het
Npc1l1 T C 11: 6,218,723 Y886C probably damaging Het
Nsmaf T C 4: 6,398,542 probably null Het
Ntn4 C T 10: 93,644,500 R29C probably damaging Het
Olfr74 T A 2: 87,973,751 I305L probably benign Het
Plppr2 A G 9: 21,944,514 N261S probably damaging Het
Prkar2a T A 9: 108,740,385 probably benign Het
Pxk G A 14: 8,144,133 V294M probably damaging Het
Rars A G 11: 35,809,146 F608L possibly damaging Het
Rasa3 A G 8: 13,614,633 F60L probably damaging Het
Rbm47 C T 5: 66,019,304 A490T possibly damaging Het
Sardh T C 2: 27,189,527 I918V probably benign Het
Sdhc T C 1: 171,136,057 Y80C probably damaging Het
Selp T A 1: 164,143,936 M653K probably damaging Het
Slc6a17 T C 3: 107,500,487 D56G possibly damaging Het
Slco1b2 T C 6: 141,669,469 S367P probably damaging Het
Spry4 TTGAGGTCC T 18: 38,590,275 probably null Het
Strip2 T A 6: 29,925,093 Y143* probably null Het
Sycp2 T C 2: 178,393,961 probably benign Het
Tex30 C A 1: 44,086,958 V204L possibly damaging Het
Tex45 A G 8: 3,479,004 K193R possibly damaging Het
Tln2 G T 9: 67,331,733 T1087K probably benign Het
Tmeff2 A C 1: 50,979,387 N176T probably benign Het
Togaram2 C G 17: 71,697,923 T324R probably damaging Het
Trpc3 C T 3: 36,634,382 R836Q probably benign Het
Trpm7 A C 2: 126,831,229 L535V probably benign Het
Vmn1r213 G A 13: 23,011,605 W119* probably null Het
Vps29 T G 5: 122,362,888 V176G probably damaging Het
Vsig10l A G 7: 43,463,749 T144A possibly damaging Het
Wdr11 T C 7: 129,628,022 Y844H probably benign Het
Zbp1 A T 2: 173,212,206 M174K probably damaging Het
Zfp341 G A 2: 154,645,866 probably benign Het
Zfp638 G A 6: 83,943,058 R546H probably damaging Het
Zfp820 A T 17: 21,823,872 M1K probably null Het
Other mutations in Ddx24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02063:Ddx24 APN 12 103418202 missense probably damaging 0.97
IGL02102:Ddx24 APN 12 103408484 intron probably benign
IGL02225:Ddx24 APN 12 103417371 missense probably damaging 1.00
IGL02226:Ddx24 APN 12 103424458 missense possibly damaging 0.81
IGL02325:Ddx24 APN 12 103416266 missense probably damaging 1.00
IGL02568:Ddx24 APN 12 103417312 missense probably damaging 1.00
IGL02666:Ddx24 APN 12 103424055 missense possibly damaging 0.94
IGL02950:Ddx24 APN 12 103417542 missense probably damaging 1.00
IGL03244:Ddx24 APN 12 103417605 missense possibly damaging 0.53
P0028:Ddx24 UTSW 12 103408375 missense probably benign
R0195:Ddx24 UTSW 12 103418961 critical splice donor site probably null
R0540:Ddx24 UTSW 12 103419067 missense possibly damaging 0.92
R0607:Ddx24 UTSW 12 103419067 missense possibly damaging 0.92
R0621:Ddx24 UTSW 12 103425558 intron probably benign
R0964:Ddx24 UTSW 12 103423907 missense probably damaging 1.00
R1447:Ddx24 UTSW 12 103424307 missense possibly damaging 0.88
R1639:Ddx24 UTSW 12 103411319 critical splice acceptor site probably null
R1909:Ddx24 UTSW 12 103409982 missense probably damaging 0.99
R2418:Ddx24 UTSW 12 103417737 missense probably damaging 1.00
R3706:Ddx24 UTSW 12 103417416 missense probably damaging 1.00
R3725:Ddx24 UTSW 12 103417605 missense probably benign 0.19
R4436:Ddx24 UTSW 12 103423974 missense probably damaging 1.00
R5568:Ddx24 UTSW 12 103424288 missense possibly damaging 0.46
R5629:Ddx24 UTSW 12 103425547 intron probably benign
R5763:Ddx24 UTSW 12 103417414 missense probably damaging 1.00
R5891:Ddx24 UTSW 12 103424058 missense probably damaging 1.00
R6059:Ddx24 UTSW 12 103408300 missense probably damaging 1.00
R6310:Ddx24 UTSW 12 103423907 missense probably damaging 1.00
R6311:Ddx24 UTSW 12 103423907 missense probably damaging 1.00
R6408:Ddx24 UTSW 12 103425560 intron probably benign
R6648:Ddx24 UTSW 12 103408375 missense probably benign 0.02
R7151:Ddx24 UTSW 12 103424088 missense probably benign 0.00
R7299:Ddx24 UTSW 12 103419450 missense possibly damaging 0.95
R7301:Ddx24 UTSW 12 103419450 missense possibly damaging 0.95
R7324:Ddx24 UTSW 12 103416259 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTGTGCTTCAGTCTCAATTC -3'
(R):5'- ATAGTACCAGCACACTGCCTTTC -3'

Sequencing Primer
(F):5'- CAATTCTGGCCTCCTCAGG -3'
(R):5'- TTCCTTGATAGCCAGGTGC -3'
Posted On2016-02-04