Incidental Mutation 'R4807:Zfp820'
ID370792
Institutional Source Beutler Lab
Gene Symbol Zfp820
Ensembl Gene ENSMUSG00000069743
Gene Namezinc finger protein 820
Synonyms2610036F08Rik
MMRRC Submission 042426-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R4807 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location21816876-21845759 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 21823872 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000081158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084141]
Predicted Effect probably null
Transcript: ENSMUST00000084141
AA Change: M1K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081158
Gene: ENSMUSG00000069743
AA Change: M1K

DomainStartEndE-ValueType
KRAB 13 73 8.77e-20 SMART
ZnF_C2H2 183 205 6.32e-3 SMART
ZnF_C2H2 211 233 2.79e-4 SMART
ZnF_C2H2 239 261 4.3e-5 SMART
ZnF_C2H2 267 289 4.61e-5 SMART
ZnF_C2H2 295 317 1.2e-3 SMART
ZnF_C2H2 323 345 1.22e-4 SMART
ZnF_C2H2 351 373 2.75e-3 SMART
ZnF_C2H2 379 401 2.95e-3 SMART
ZnF_C2H2 407 429 5.29e-5 SMART
ZnF_C2H2 435 457 1.42e-5 SMART
ZnF_C2H2 463 485 1.2e-3 SMART
ZnF_C2H2 491 513 1.13e-4 SMART
Meta Mutation Damage Score 0.6116 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (86/88)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 C T 7: 120,540,609 A1499V probably damaging Het
Agap3 T A 5: 24,477,116 D386E probably damaging Het
Ahdc1 C A 4: 133,064,313 T955K possibly damaging Het
Ankrd9 A G 12: 110,977,235 Y122H probably benign Het
Apc2 G T 10: 80,314,362 R1721L probably benign Het
Arfgef3 A G 10: 18,646,637 V547A probably benign Het
Arhgap42 T C 9: 9,046,628 N203D possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Aspm T A 1: 139,477,919 F1515I probably damaging Het
Baz1a T C 12: 54,898,482 T1363A probably benign Het
Cacng3 C T 7: 122,754,509 A72V probably benign Het
Casp8ap2 T C 4: 32,644,505 C1193R possibly damaging Het
Ccr3 A G 9: 124,029,297 Y223C probably damaging Het
Clcn3 C A 8: 60,934,530 L201F probably damaging Het
Cltc A C 11: 86,701,076 probably benign Het
Cyp19a1 G T 9: 54,176,646 T86K possibly damaging Het
Ddx24 A T 12: 103,419,461 F248L probably damaging Het
Ddx60 G A 8: 61,979,338 V885I probably damaging Het
Dync2h1 T C 9: 7,139,422 I1404M probably benign Het
Emilin2 A T 17: 71,273,448 V761E probably damaging Het
Endou C T 15: 97,731,232 C13Y probably benign Het
Ep400 C A 5: 110,695,578 probably null Het
Fbxo33 C A 12: 59,219,212 D90Y probably damaging Het
Fryl A G 5: 73,041,362 F2641L probably benign Het
Gbp2b A G 3: 142,598,245 I34V probably benign Het
Ghdc T C 11: 100,770,225 H38R probably damaging Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gpr63 A C 4: 25,007,446 M57L probably benign Het
Gprc5c A G 11: 114,864,498 S3G probably damaging Het
Grk4 A T 5: 34,752,208 M539L probably benign Het
Gulo C T 14: 65,990,384 M366I probably benign Het
Heatr5a T C 12: 51,877,520 H1970R probably damaging Het
Hmbox1 T C 14: 64,825,549 probably benign Het
Ighg2b T C 12: 113,304,345 probably benign Het
Il1b A T 2: 129,370,306 C9S probably benign Het
Itpkb A T 1: 180,334,875 probably benign Het
Kcnn1 T A 8: 70,848,178 H473L probably damaging Het
Kidins220 C T 12: 25,057,285 S1579L probably damaging Het
Kif1b A T 4: 149,247,921 probably benign Het
Lyg2 A T 1: 37,911,067 M60K possibly damaging Het
Mak16 G T 8: 31,166,133 H107Q probably benign Het
Mapkap1 G A 2: 34,597,422 probably null Het
Mastl A G 2: 23,132,843 S623P probably benign Het
Mccc1 T C 3: 35,985,046 Y46C probably damaging Het
Mdn1 T G 4: 32,685,651 probably null Het
Med25 T A 7: 44,884,619 T31S probably benign Het
Mprip G A 11: 59,758,020 G850D probably benign Het
Mrpl10 T C 11: 97,041,623 I8T probably benign Het
Msr1 T C 8: 39,642,627 probably benign Het
Myo3b T A 2: 70,105,712 I99N probably damaging Het
Neurod6 A T 6: 55,678,655 N332K probably damaging Het
Npc1l1 T C 11: 6,218,723 Y886C probably damaging Het
Nsmaf T C 4: 6,398,542 probably null Het
Ntn4 C T 10: 93,644,500 R29C probably damaging Het
Olfr74 T A 2: 87,973,751 I305L probably benign Het
Plppr2 A G 9: 21,944,514 N261S probably damaging Het
Prkar2a T A 9: 108,740,385 probably benign Het
Pxk G A 14: 8,144,133 V294M probably damaging Het
Rars A G 11: 35,809,146 F608L possibly damaging Het
Rasa3 A G 8: 13,614,633 F60L probably damaging Het
Rbm47 C T 5: 66,019,304 A490T possibly damaging Het
Sardh T C 2: 27,189,527 I918V probably benign Het
Sdhc T C 1: 171,136,057 Y80C probably damaging Het
Selp T A 1: 164,143,936 M653K probably damaging Het
Slc6a17 T C 3: 107,500,487 D56G possibly damaging Het
Slco1b2 T C 6: 141,669,469 S367P probably damaging Het
Spry4 TTGAGGTCC T 18: 38,590,275 probably null Het
Strip2 T A 6: 29,925,093 Y143* probably null Het
Sycp2 T C 2: 178,393,961 probably benign Het
Tex30 C A 1: 44,086,958 V204L possibly damaging Het
Tex45 A G 8: 3,479,004 K193R possibly damaging Het
Tln2 G T 9: 67,331,733 T1087K probably benign Het
Tmeff2 A C 1: 50,979,387 N176T probably benign Het
Togaram2 C G 17: 71,697,923 T324R probably damaging Het
Trpc3 C T 3: 36,634,382 R836Q probably benign Het
Trpm7 A C 2: 126,831,229 L535V probably benign Het
Vmn1r213 G A 13: 23,011,605 W119* probably null Het
Vps29 T G 5: 122,362,888 V176G probably damaging Het
Vsig10l A G 7: 43,463,749 T144A possibly damaging Het
Wdr11 T C 7: 129,628,022 Y844H probably benign Het
Zbp1 A T 2: 173,212,206 M174K probably damaging Het
Zfp341 G A 2: 154,645,866 probably benign Het
Zfp638 G A 6: 83,943,058 R546H probably damaging Het
Other mutations in Zfp820
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Zfp820 APN 17 21819311 missense probably damaging 1.00
IGL00954:Zfp820 APN 17 21819879 missense probably damaging 1.00
IGL01088:Zfp820 APN 17 21821181 nonsense probably null
IGL03067:Zfp820 APN 17 21819820 missense possibly damaging 0.68
R0158:Zfp820 UTSW 17 21819819 missense probably benign 0.06
R0617:Zfp820 UTSW 17 21819704 missense probably damaging 0.99
R0658:Zfp820 UTSW 17 21818920 missense probably benign 0.00
R0696:Zfp820 UTSW 17 21820060 missense possibly damaging 0.94
R0791:Zfp820 UTSW 17 21819528 missense probably benign 0.05
R0792:Zfp820 UTSW 17 21819528 missense probably benign 0.05
R0882:Zfp820 UTSW 17 21823836 splice site probably benign
R1421:Zfp820 UTSW 17 21819880 missense possibly damaging 0.85
R1573:Zfp820 UTSW 17 21818756 missense probably benign 0.00
R1928:Zfp820 UTSW 17 21819335 missense probably benign 0.00
R3889:Zfp820 UTSW 17 21818896 missense probably benign 0.25
R4782:Zfp820 UTSW 17 21818985 missense probably benign 0.00
R4799:Zfp820 UTSW 17 21818985 missense probably benign 0.00
R4913:Zfp820 UTSW 17 21819219 missense probably benign 0.42
R5100:Zfp820 UTSW 17 21821073 missense possibly damaging 0.64
R5766:Zfp820 UTSW 17 21820002 missense probably damaging 0.96
R5772:Zfp820 UTSW 17 21818721 missense probably damaging 1.00
R6516:Zfp820 UTSW 17 21819373 missense probably damaging 1.00
R6577:Zfp820 UTSW 17 21819403 missense probably benign 0.00
R7094:Zfp820 UTSW 17 21819265 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- ATAGTAGCACAAGGCCGTG -3'
(R):5'- AGCAGTGTTTTACAGCAGGTG -3'

Sequencing Primer
(F):5'- ACAAGGCCGTGCTTGTC -3'
(R):5'- GTTTTTGCCTGGTACCTACTAAG -3'
Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation.
 

PCR Primers

R48070084_PCR_F: 5’- ATAGTAGCACAAGGCCGTG-3’

R48070084_PCR_R: 5’- AGCAGTGTTTTACAGCAGGTG-3’

 

Sequencing Primers

R48070084_SEQ_F: 5’- ACAAGGCCGTGCTTGTC-3’
 

R48070084_SEQ_R: 5’- GTTTTTGCCTGGTACCTACTAAG-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 459 nucleotides is amplified (Chr17: 21823670-21824128; NC_000083):

 

atagtagcac aaggccgtgc ttgtcttatt tgaagtgaaa gatctaaagg cttaattttg       

aacaaagata aattgcagaa accaaacacg tttggtaaca ttaccagagg tagagaacta      

aaatctctac ctctaaaaat agaaattttt aagaaatgta gacaagacac tgacctgagg      

aacatttagg agagaagcat tcattcttct tgttactctt acctgaaaaa ttaaaagcaa      

aaataaattc aagtctgtta tgaacaatgc taaaccatat aaaaacatac aaaaaggaaa      

atgataccag aaaacttgcc aacattccta cagaaaggag agcatggaat gatatattta      

atgtggtaag gaaaataact acattttgtg gcctttttct aaccttagta ggtaccaggc      

aaaaacagag tacacacaca cctgctgtaa aacactgct

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. (+) = A>T).

Posted On2016-02-04