Incidental Mutation 'R4808:Snap25'
ID370807
Institutional Source Beutler Lab
Gene Symbol Snap25
Ensembl Gene ENSMUSG00000027273
Gene Namesynaptosomal-associated protein 25
SynonymsBdr, SNAP-25, GENA 70, sp
MMRRC Submission 042427-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4808 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location136713453-136782428 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136770102 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 70 (D70G)
Ref Sequence ENSEMBL: ENSMUSP00000028727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028727] [ENSMUST00000110098]
PDB Structure
[]
Predicted Effect probably damaging
Transcript: ENSMUST00000028727
AA Change: D70G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028727
Gene: ENSMUSG00000027273
AA Change: D70G

DomainStartEndE-ValueType
t_SNARE 14 81 1.93e-12 SMART
t_SNARE 135 202 4.93e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110098
SMART Domains Protein: ENSMUSP00000105725
Gene: ENSMUSG00000027273

DomainStartEndE-ValueType
t_SNARE 14 81 9.51e-12 SMART
t_SNARE 135 202 4.93e-19 SMART
Meta Mutation Damage Score 0.34 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Synaptic vesicle membrane docking and fusion is mediated by SNAREs (soluble N-ethylmaleimide-sensitive factor attachment protein receptors) located on the vesicle membrane (v-SNAREs) and the target membrane (t-SNAREs). The assembled v-SNARE/t-SNARE complex consists of a bundle of four helices, one of which is supplied by v-SNARE and the other three by t-SNARE. For t-SNAREs on the plasma membrane, the protein syntaxin supplies one helix and the protein encoded by this gene contributes the other two. Therefore, this gene product is a presynaptic plasma membrane protein involved in the regulation of neurotransmitter release. Two alternative transcript variants encoding different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation are small size, blotchy in appearance, have dilated vascular channels, and brain defects, lack spontaneous or reflexive movement and evoked neurotransmitter release at E18.5, and die at birth. An ENU-induced mutant displays neurological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
Abi3bp A G 16: 56,594,516 D347G probably damaging Het
Adora2a A G 10: 75,333,446 N248S probably damaging Het
Agap3 T C 5: 24,501,245 F836L probably benign Het
Arap2 G A 5: 62,730,641 T454M probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atm A G 9: 53,445,495 S2819P probably damaging Het
Atp8b1 A G 18: 64,561,711 F500S probably benign Het
Catsper1 G A 19: 5,344,136 D682N possibly damaging Het
Ccdc105 A T 10: 78,752,864 D37E probably benign Het
Chordc1 A G 9: 18,292,413 Y6C probably damaging Het
Cped1 A G 6: 22,088,757 K273R probably damaging Het
Crat T C 2: 30,410,021 I116V probably benign Het
Cyp26a1 A G 19: 37,701,125 H423R probably benign Het
Cyp4f40 A G 17: 32,674,275 E360G probably benign Het
D430041D05Rik A C 2: 104,201,110 probably null Het
Eif3i A T 4: 129,592,064 F323I probably benign Het
Fam53a A G 5: 33,607,679 S228P probably damaging Het
Gm10305 C T 4: 99,273,244 noncoding transcript Het
Gm7347 C T 5: 26,054,997 R185H probably benign Het
Golga2 G T 2: 32,303,214 A441S probably benign Het
Gphn T A 12: 78,654,880 S608T probably benign Het
Gramd1b A T 9: 40,304,349 V620E possibly damaging Het
H2-M9 T C 17: 36,640,792 T264A probably damaging Het
Hist2h2bb T G 3: 96,270,013 S88A probably benign Het
Hjurp G C 1: 88,277,215 probably benign Het
Hsd3b6 G A 3: 98,806,285 H233Y probably damaging Het
Ighv6-7 T A 12: 114,455,721 R88* probably null Het
Jup C T 11: 100,378,192 R465H probably damaging Het
Kif16b A T 2: 142,857,358 Y101N probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mapkap1 G A 2: 34,597,422 probably null Het
Myocos T C 1: 162,657,040 probably benign Het
Nav1 C T 1: 135,455,204 G1197S probably damaging Het
Oas1g T G 5: 120,879,322 K223T possibly damaging Het
Olfr293 A G 7: 86,663,938 D92G probably benign Het
Olfr577 T C 7: 102,973,911 H27R probably damaging Het
Oprd1 G A 4: 132,117,394 T101M probably damaging Het
Pcdha7 G A 18: 36,974,228 C102Y probably damaging Het
Pcx T A 19: 4,620,928 S1086T probably benign Het
Pde8a A G 7: 81,282,931 T114A probably benign Het
Pias4 A G 10: 81,155,840 probably null Het
Pkn3 G A 2: 30,090,081 G750E probably damaging Het
Pramel5 G A 4: 144,272,755 A254V probably benign Het
Ptprq A G 10: 107,718,507 L119P probably damaging Het
Rasgrf2 A T 13: 92,023,682 L395Q probably damaging Het
Rbm19 T C 5: 120,118,774 S51P probably damaging Het
Rfx5 A G 3: 94,958,280 T297A probably benign Het
Scaf1 T C 7: 45,008,639 E272G probably damaging Het
Slc24a2 G T 4: 87,032,238 Q396K probably benign Het
Slc39a14 T C 14: 70,315,801 I162V probably damaging Het
Spata31d1b C T 13: 59,715,721 P228S probably benign Het
Sppl3 T A 5: 115,083,426 probably benign Het
Sspo A G 6: 48,451,161 D314G probably damaging Het
Steap1 G T 5: 5,738,829 probably benign Het
Suox T A 10: 128,671,889 D90V possibly damaging Het
Sycp2 T C 2: 178,393,961 probably benign Het
Tln2 G T 9: 67,331,733 T1087K probably benign Het
Uap1l1 A G 2: 25,362,085 S473P probably damaging Het
Xpo5 T A 17: 46,235,970 N882K probably benign Het
Zfp536 A T 7: 37,479,305 C228S probably damaging Het
Other mutations in Snap25
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0281:Snap25 UTSW 2 136777464 missense probably damaging 0.99
R1257:Snap25 UTSW 2 136758348 missense probably damaging 1.00
R1547:Snap25 UTSW 2 136777469 missense possibly damaging 0.86
R1880:Snap25 UTSW 2 136777385 missense probably damaging 1.00
R2030:Snap25 UTSW 2 136770053 intron probably benign
R6968:Snap25 UTSW 2 136769770 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GTACCAGCTCTAATCTGTGGC -3'
(R):5'- ATGCCACATGCTCATCCTG -3'

Sequencing Primer
(F):5'- AGCTCTAATCTGTGGCGTCCAG -3'
(R):5'- TGCCTATGAGCCTGCAGGAATG -3'
Posted On2016-02-04