Incidental Mutation 'R4808:Adora2a'
ID370840
Institutional Source Beutler Lab
Gene Symbol Adora2a
Ensembl Gene ENSMUSG00000020178
Gene Nameadenosine A2a receptor
SynonymsA2AAR, AA2AR, A2aR, A2a, Rs
MMRRC Submission 042427-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4808 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location75316877-75334784 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75333446 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 248 (N248S)
Ref Sequence ENSEMBL: ENSMUSP00000101060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105420]
Predicted Effect probably damaging
Transcript: ENSMUST00000105420
AA Change: N248S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101060
Gene: ENSMUSG00000020178
AA Change: N248S

DomainStartEndE-ValueType
Pfam:7tm_4 11 301 1.9e-9 PFAM
Pfam:7TM_GPCR_Srsx 14 298 5.1e-15 PFAM
Pfam:7tm_1 20 283 3.1e-62 PFAM
low complexity region 355 371 N/A INTRINSIC
Meta Mutation Damage Score 0.296 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor (GPCR) superfamily, which is subdivided into classes and subtypes. The receptors are seven-pass transmembrane proteins that respond to extracellular cues and activate intracellular signal transduction pathways. This protein, an adenosine receptor of A2A subtype, uses adenosine as the preferred endogenous agonist and preferentially interacts with the G(s) and G(olf) family of G proteins to increase intracellular cAMP levels. It plays an important role in many biological functions, such as cardiac rhythm and circulation, cerebral and renal blood flow, immune function, pain regulation, and sleep. It has been implicated in pathophysiological conditions such as inflammatory diseases and neurodegenerative disorders. Alternative splicing results in multiple transcript variants. A read-through transcript composed of the upstream SPECC1L (sperm antigen with calponin homology and coiled-coil domains 1-like) and ADORA2A (adenosine A2a receptor) gene sequence has been identified, but it is thought to be non-coding. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are viable and fertile with reduced exploratory activity and displaying depressive rather than stimulatory response to caffeine. Mutants test more anxious, were more aggressive towards intruders, and slower to respond to pain stimuli. Blood pressure and heart rate are increased, as well as platelet aggregation rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
Abi3bp A G 16: 56,594,516 D347G probably damaging Het
Agap3 T C 5: 24,501,245 F836L probably benign Het
Arap2 G A 5: 62,730,641 T454M probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atm A G 9: 53,445,495 S2819P probably damaging Het
Atp8b1 A G 18: 64,561,711 F500S probably benign Het
Catsper1 G A 19: 5,344,136 D682N possibly damaging Het
Ccdc105 A T 10: 78,752,864 D37E probably benign Het
Chordc1 A G 9: 18,292,413 Y6C probably damaging Het
Cped1 A G 6: 22,088,757 K273R probably damaging Het
Crat T C 2: 30,410,021 I116V probably benign Het
Cyp26a1 A G 19: 37,701,125 H423R probably benign Het
Cyp4f40 A G 17: 32,674,275 E360G probably benign Het
D430041D05Rik A C 2: 104,201,110 probably null Het
Eif3i A T 4: 129,592,064 F323I probably benign Het
Fam53a A G 5: 33,607,679 S228P probably damaging Het
Gm10305 C T 4: 99,273,244 noncoding transcript Het
Gm7347 C T 5: 26,054,997 R185H probably benign Het
Golga2 G T 2: 32,303,214 A441S probably benign Het
Gphn T A 12: 78,654,880 S608T probably benign Het
Gramd1b A T 9: 40,304,349 V620E possibly damaging Het
H2-M9 T C 17: 36,640,792 T264A probably damaging Het
Hist2h2bb T G 3: 96,270,013 S88A probably benign Het
Hjurp G C 1: 88,277,215 probably benign Het
Hsd3b6 G A 3: 98,806,285 H233Y probably damaging Het
Ighv6-7 T A 12: 114,455,721 R88* probably null Het
Jup C T 11: 100,378,192 R465H probably damaging Het
Kif16b A T 2: 142,857,358 Y101N probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mapkap1 G A 2: 34,597,422 probably null Het
Myocos T C 1: 162,657,040 probably benign Het
Nav1 C T 1: 135,455,204 G1197S probably damaging Het
Oas1g T G 5: 120,879,322 K223T possibly damaging Het
Olfr293 A G 7: 86,663,938 D92G probably benign Het
Olfr577 T C 7: 102,973,911 H27R probably damaging Het
Oprd1 G A 4: 132,117,394 T101M probably damaging Het
Pcdha7 G A 18: 36,974,228 C102Y probably damaging Het
Pcx T A 19: 4,620,928 S1086T probably benign Het
Pde8a A G 7: 81,282,931 T114A probably benign Het
Pias4 A G 10: 81,155,840 probably null Het
Pkn3 G A 2: 30,090,081 G750E probably damaging Het
Pramel5 G A 4: 144,272,755 A254V probably benign Het
Ptprq A G 10: 107,718,507 L119P probably damaging Het
Rasgrf2 A T 13: 92,023,682 L395Q probably damaging Het
Rbm19 T C 5: 120,118,774 S51P probably damaging Het
Rfx5 A G 3: 94,958,280 T297A probably benign Het
Scaf1 T C 7: 45,008,639 E272G probably damaging Het
Slc24a2 G T 4: 87,032,238 Q396K probably benign Het
Slc39a14 T C 14: 70,315,801 I162V probably damaging Het
Snap25 A G 2: 136,770,102 D70G probably damaging Het
Spata31d1b C T 13: 59,715,721 P228S probably benign Het
Sppl3 T A 5: 115,083,426 probably benign Het
Sspo A G 6: 48,451,161 D314G probably damaging Het
Steap1 G T 5: 5,738,829 probably benign Het
Suox T A 10: 128,671,889 D90V possibly damaging Het
Sycp2 T C 2: 178,393,961 probably benign Het
Tln2 G T 9: 67,331,733 T1087K probably benign Het
Uap1l1 A G 2: 25,362,085 S473P probably damaging Het
Xpo5 T A 17: 46,235,970 N882K probably benign Het
Zfp536 A T 7: 37,479,305 C228S probably damaging Het
Other mutations in Adora2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Adora2a APN 10 75333451 missense probably damaging 0.99
IGL01298:Adora2a APN 10 75333492 missense probably damaging 1.00
R1217:Adora2a UTSW 10 75333215 missense probably damaging 1.00
R1983:Adora2a UTSW 10 75333646 missense probably benign 0.04
R2329:Adora2a UTSW 10 75326183 missense probably damaging 1.00
R4884:Adora2a UTSW 10 75326045 missense probably null 0.99
R5056:Adora2a UTSW 10 75326158 missense probably damaging 1.00
R5250:Adora2a UTSW 10 75326048 missense probably damaging 1.00
R6153:Adora2a UTSW 10 75326147 missense possibly damaging 0.78
R6306:Adora2a UTSW 10 75333404 missense probably damaging 1.00
R6746:Adora2a UTSW 10 75333608 missense probably benign 0.12
R7047:Adora2a UTSW 10 75326311 missense probably damaging 1.00
X0017:Adora2a UTSW 10 75333563 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTGGCCATCTACCTAAGG -3'
(R):5'- TAAGAAGCTCTACATCCCCAGGAG -3'

Sequencing Primer
(F):5'- CACACTGCAGAAGGAAGT -3'
(R):5'- ATTGGCCCATACTCCCAGG -3'
Posted On2016-02-04