Incidental Mutation 'R4810:Ankrd44'
ID370957
Institutional Source Beutler Lab
Gene Symbol Ankrd44
Ensembl Gene ENSMUSG00000052331
Gene Nameankyrin repeat domain 44
SynonymsE130014H08Rik
MMRRC Submission 042429-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R4810 (G1)
Quality Score138
Status Validated
Chromosome1
Chromosomal Location54645340-54926387 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 54735143 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044359] [ENSMUST00000178226] [ENSMUST00000179030]
Predicted Effect probably benign
Transcript: ENSMUST00000044359
SMART Domains Protein: ENSMUSP00000040327
Gene: ENSMUSG00000052331

DomainStartEndE-ValueType
ANK 7 36 2.55e2 SMART
ANK 40 69 3.23e-4 SMART
ANK 73 102 1.12e-3 SMART
ANK 106 135 1.65e-1 SMART
ANK 139 168 1.6e-8 SMART
ANK 172 201 4.97e-5 SMART
ANK 205 234 1.1e-6 SMART
ANK 238 267 9.7e-8 SMART
ANK 271 301 1.11e-2 SMART
ANK 305 334 9.35e-1 SMART
ANK 338 367 2.02e-5 SMART
ANK 371 400 5.98e1 SMART
ANK 422 451 7.13e-6 SMART
ANK 455 484 1.18e-6 SMART
ANK 488 545 1.17e2 SMART
ANK 549 579 3.31e-1 SMART
ANK 584 613 3.91e-3 SMART
ANK 617 646 1.43e-5 SMART
ANK 651 680 2.73e-2 SMART
ANK 687 716 5.41e-6 SMART
ANK 720 749 5.53e-3 SMART
ANK 753 785 1.52e0 SMART
ANK 789 819 9.27e-5 SMART
ANK 821 851 1.52e0 SMART
ANK 856 885 6.02e-4 SMART
ANK 889 919 3.08e-1 SMART
ANK 923 955 3.36e-2 SMART
ANK 959 988 6.26e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178226
SMART Domains Protein: ENSMUSP00000136802
Gene: ENSMUSG00000052331

DomainStartEndE-ValueType
ANK 2 31 1.1e-6 SMART
ANK 35 64 9.7e-8 SMART
ANK 68 98 1.11e-2 SMART
ANK 102 131 9.35e-1 SMART
ANK 135 164 2.02e-5 SMART
ANK 168 197 5.98e1 SMART
ANK 219 248 7.13e-6 SMART
ANK 252 281 1.18e-6 SMART
ANK 285 342 1.17e2 SMART
ANK 346 376 3.31e-1 SMART
ANK 381 410 3.91e-3 SMART
ANK 414 443 1.43e-5 SMART
ANK 448 477 2.73e-2 SMART
ANK 484 513 5.41e-6 SMART
ANK 517 546 5.53e-3 SMART
ANK 550 582 1.52e0 SMART
ANK 586 616 9.27e-5 SMART
ANK 618 648 1.52e0 SMART
ANK 653 682 6.02e-4 SMART
ANK 686 716 3.08e-1 SMART
ANK 720 752 3.36e-2 SMART
ANK 756 785 6.26e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178935
Predicted Effect probably benign
Transcript: ENSMUST00000179030
SMART Domains Protein: ENSMUSP00000137616
Gene: ENSMUSG00000052331

DomainStartEndE-ValueType
ANK 7 36 2.55e2 SMART
ANK 40 69 3.23e-4 SMART
ANK 73 102 1.12e-3 SMART
ANK 106 135 1.65e-1 SMART
ANK 139 168 1.6e-8 SMART
ANK 172 201 4.97e-5 SMART
ANK 205 234 1.1e-6 SMART
ANK 238 267 9.7e-8 SMART
ANK 271 301 1.11e-2 SMART
ANK 305 334 9.35e-1 SMART
ANK 338 367 2.02e-5 SMART
ANK 371 400 3.26e0 SMART
ANK 404 433 7.13e-6 SMART
ANK 437 466 1.18e-6 SMART
ANK 470 527 1.17e2 SMART
ANK 531 561 3.31e-1 SMART
ANK 566 595 3.91e-3 SMART
ANK 599 628 1.43e-5 SMART
ANK 633 662 2.73e-2 SMART
ANK 669 698 5.41e-6 SMART
ANK 702 731 5.53e-3 SMART
ANK 735 767 1.52e0 SMART
ANK 771 801 9.27e-5 SMART
ANK 803 833 1.52e0 SMART
ANK 838 867 6.02e-4 SMART
ANK 871 901 3.08e-1 SMART
ANK 905 937 3.36e-2 SMART
ANK 941 970 6.26e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191996
Meta Mutation Damage Score 0.0688 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 99% (93/94)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A G 9: 92,354,630 D190G probably damaging Het
2700049A03Rik T C 12: 71,189,442 V1189A possibly damaging Het
5330417C22Rik T A 3: 108,470,011 probably benign Het
A3galt2 T C 4: 128,755,563 probably null Het
Abca12 T C 1: 71,303,612 D903G probably benign Het
Abcc12 T C 8: 86,560,842 M125V probably damaging Het
Adad1 A G 3: 37,092,034 N517S probably damaging Het
Armc7 A G 11: 115,488,961 I162V probably benign Het
Art3 T A 5: 92,414,249 V343D possibly damaging Het
Bcl9l A G 9: 44,508,353 T1106A probably damaging Het
Ccdc141 T C 2: 77,045,755 N644D possibly damaging Het
Ccdc154 T C 17: 25,163,498 L98S probably damaging Het
Ccne1 A G 7: 38,099,593 W237R probably damaging Het
Cd33 T C 7: 43,532,710 I104V probably damaging Het
Ceacam1 A T 7: 25,474,520 *237K probably null Het
Ces1e T A 8: 93,208,631 I398F probably benign Het
Cfap44 T C 16: 44,451,535 I1217T probably damaging Het
Clns1a T C 7: 97,714,017 S199P probably benign Het
Cntn4 C A 6: 106,655,611 T532K probably benign Het
Col11a2 C T 17: 34,057,112 S470L probably damaging Het
Cst10 A T 2: 149,405,543 R60* probably null Het
Cxcr6 A T 9: 123,810,162 D83V probably damaging Het
Dis3l2 T C 1: 87,047,574 V774A probably damaging Het
Dusp15 A G 2: 152,945,454 L79P probably damaging Het
Eml6 A T 11: 29,755,011 V1511E possibly damaging Het
Epha5 C T 5: 84,105,891 D548N possibly damaging Het
Fam227b A G 2: 125,987,939 F450L probably benign Het
Fam91a1 T A 15: 58,434,740 L452Q probably damaging Het
Fbxo44 T C 4: 148,156,446 Y199C probably damaging Het
Fgd3 A G 13: 49,289,650 S149P probably benign Het
Gabra4 T C 5: 71,623,982 E362G probably damaging Het
Galnt14 T C 17: 73,512,121 I325V probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm10088 G T 16: 19,028,331 noncoding transcript Het
Grik5 T C 7: 25,015,497 N691D probably damaging Het
Grm1 C G 10: 10,782,694 D351H probably damaging Het
Grm8 T C 6: 27,761,296 S310G possibly damaging Het
Gtf2h2 A G 13: 100,481,002 probably null Het
Hhex G T 19: 37,439,655 L49F probably damaging Het
Hkdc1 T A 10: 62,411,525 R159S probably benign Het
Iqcm A G 8: 75,888,653 Y454C probably damaging Het
Kcnh8 G A 17: 52,905,220 probably null Het
Larp4b A G 13: 9,158,591 T427A probably benign Het
Mtmr3 A T 11: 4,498,046 N297K probably benign Het
Nek8 G A 11: 78,167,803 T557I probably benign Het
Nlrp9c A C 7: 26,378,177 probably null Het
Nmrk1 T A 19: 18,639,909 D48E probably benign Het
Npepps G A 11: 97,240,933 T365I probably damaging Het
Obscn G A 11: 59,031,591 T5921M possibly damaging Het
Olfr25 A G 9: 38,330,394 E269G probably benign Het
Olfr907 C A 9: 38,499,324 Y218* probably null Het
Otud7b C T 3: 96,136,607 A23V probably damaging Het
Pcdhga9 G A 18: 37,738,548 A477T possibly damaging Het
Plekha7 A T 7: 116,144,938 I663N probably damaging Het
Polk A T 13: 96,483,495 S732R possibly damaging Het
Ppfia2 A G 10: 106,915,690 I1166V probably benign Het
Ppp2r5a C T 1: 191,356,392 probably benign Het
Prkaa2 T C 4: 105,039,814 K401E probably damaging Het
Ptpn23 A G 9: 110,389,136 Y611H possibly damaging Het
Rab31 C T 17: 65,722,003 probably null Het
Rad51ap2 T A 12: 11,457,405 C443S probably damaging Het
Ralgapa1 A G 12: 55,794,993 probably null Het
Rev3l T C 10: 39,823,725 L1406P probably benign Het
Rnaset2b T A 17: 6,991,768 D48E probably benign Het
Rnf13 G T 3: 57,796,272 M105I probably damaging Het
Rnf150 T C 8: 82,990,362 V166A possibly damaging Het
Rps6kc1 C A 1: 190,808,963 R381L probably damaging Het
Rspo2 C T 15: 43,169,820 R2H probably benign Het
Sept8 A G 11: 53,534,589 D103G probably damaging Het
Sirt4 A G 5: 115,480,449 W189R probably damaging Het
Slco6d1 T C 1: 98,423,254 V110A possibly damaging Het
Sncaip C A 18: 52,907,199 Q822K possibly damaging Het
Spg11 A C 2: 122,059,796 F2070V probably damaging Het
Sptb A T 12: 76,623,197 Y452* probably null Het
Srsf4 C T 4: 131,900,102 probably benign Het
Tead1 C A 7: 112,841,866 probably null Het
Tmem156 G T 5: 65,091,447 probably benign Het
Tmem169 A G 1: 72,298,152 D82G probably benign Het
Tmem260 A G 14: 48,472,473 E51G probably damaging Het
Trim36 G T 18: 46,172,469 N470K probably benign Het
Trps1 T A 15: 50,822,296 T158S probably benign Het
Ube2c A G 2: 164,772,562 *180W probably null Het
Ube2i T C 17: 25,265,147 D45G probably benign Het
Uggt2 A C 14: 119,013,521 L1188R probably damaging Het
Uroc1 T C 6: 90,363,153 I680T probably damaging Het
Vmn2r2 T A 3: 64,137,462 M88L probably damaging Het
Zfp248 G A 6: 118,429,846 R261C possibly damaging Het
Zfp418 G T 7: 7,182,847 R603L possibly damaging Het
Zmpste24 T A 4: 121,061,054 Y457F probably damaging Het
Other mutations in Ankrd44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Ankrd44 APN 1 54662647 splice site probably benign
IGL00839:Ankrd44 APN 1 54667435 missense probably benign 0.27
IGL01145:Ankrd44 APN 1 54762259 critical splice donor site probably null
IGL01380:Ankrd44 APN 1 54727565 missense probably benign 0.00
IGL01415:Ankrd44 APN 1 54752928 missense probably damaging 1.00
IGL01958:Ankrd44 APN 1 54766966 missense probably damaging 0.99
IGL02014:Ankrd44 APN 1 54657620 missense possibly damaging 0.95
IGL02745:Ankrd44 APN 1 54766791 missense probably damaging 1.00
IGL03008:Ankrd44 APN 1 54766809 missense probably damaging 1.00
wilderness UTSW 1 54735034 synonymous silent
PIT4812001:Ankrd44 UTSW 1 54723038 nonsense probably null
R0416:Ankrd44 UTSW 1 54743339 missense possibly damaging 0.63
R0554:Ankrd44 UTSW 1 54763758 missense probably benign 0.00
R0575:Ankrd44 UTSW 1 54762310 missense probably damaging 1.00
R1323:Ankrd44 UTSW 1 54766450 splice site probably benign
R1605:Ankrd44 UTSW 1 54828622 missense probably benign 0.36
R2032:Ankrd44 UTSW 1 54723009 splice site probably null
R4458:Ankrd44 UTSW 1 54762391 missense possibly damaging 0.92
R4610:Ankrd44 UTSW 1 54766748 intron probably benign
R4727:Ankrd44 UTSW 1 54667417 missense probably benign 0.05
R4780:Ankrd44 UTSW 1 54763757 missense probably benign 0.00
R4801:Ankrd44 UTSW 1 54762316 missense probably damaging 1.00
R4802:Ankrd44 UTSW 1 54762316 missense probably damaging 1.00
R4961:Ankrd44 UTSW 1 54663912 missense probably damaging 1.00
R5053:Ankrd44 UTSW 1 54735089 nonsense probably null
R5093:Ankrd44 UTSW 1 54763718 missense probably damaging 1.00
R5155:Ankrd44 UTSW 1 54778330 missense probably benign 0.43
R5248:Ankrd44 UTSW 1 54667380 missense probably damaging 1.00
R5306:Ankrd44 UTSW 1 54926203 utr 5 prime probably benign
R5595:Ankrd44 UTSW 1 54735050 missense probably damaging 1.00
R5595:Ankrd44 UTSW 1 54762347 missense probably damaging 1.00
R6288:Ankrd44 UTSW 1 54763763 missense probably damaging 1.00
R6332:Ankrd44 UTSW 1 54762273 missense probably damaging 1.00
R6453:Ankrd44 UTSW 1 54657704 splice site probably null
R6610:Ankrd44 UTSW 1 54655087 missense probably benign 0.02
R6699:Ankrd44 UTSW 1 54762445 missense probably damaging 1.00
R6905:Ankrd44 UTSW 1 54792494 missense probably damaging 1.00
R7173:Ankrd44 UTSW 1 54766391 missense probably damaging 1.00
R7178:Ankrd44 UTSW 1 54649440 missense
R7276:Ankrd44 UTSW 1 54735080 missense probably benign 0.05
R7283:Ankrd44 UTSW 1 54729796 missense probably damaging 1.00
Z1088:Ankrd44 UTSW 1 54658982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTTCACAGGCAATTCATGTC -3'
(R):5'- AAATGTGGCCGTGGCTTAC -3'

Sequencing Primer
(F):5'- TCATCAAGTCATGAAATCACTGC -3'
(R):5'- TTACCGAGGGCTGAATGC -3'
Posted On2016-02-04