Incidental Mutation 'R4425:Nphp1'
ID371077
Institutional Source Beutler Lab
Gene Symbol Nphp1
Ensembl Gene ENSMUSG00000027378
Gene Namenephronophthisis 1 (juvenile) homolog (human)
Synonymsnephrocystin
MMRRC Submission 041144-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4425 (G1)
Quality Score73
Status Validated
Chromosome2
Chromosomal Location127740732-127788897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127788799 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 19 (E19G)
Ref Sequence ENSEMBL: ENSMUSP00000105986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028857] [ENSMUST00000110357] [ENSMUST00000135091]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028857
AA Change: E19G

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028857
Gene: ENSMUSG00000027378
AA Change: E19G

DomainStartEndE-ValueType
low complexity region 118 143 N/A INTRINSIC
SH3 158 214 5.91e-19 SMART
low complexity region 220 246 N/A INTRINSIC
Blast:14_3_3 391 491 3e-55 BLAST
low complexity region 634 641 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110357
AA Change: E19G

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105986
Gene: ENSMUSG00000027378
AA Change: E19G

DomainStartEndE-ValueType
low complexity region 118 143 N/A INTRINSIC
SH3 158 214 5.91e-19 SMART
low complexity region 220 246 N/A INTRINSIC
Blast:14_3_3 390 490 3e-55 BLAST
low complexity region 633 640 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135091
SMART Domains Protein: ENSMUSP00000141107
Gene: ENSMUSG00000051319

DomainStartEndE-ValueType
Pfam:DUF1049 1 56 1.1e-9 PFAM
Meta Mutation Damage Score 0.208 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with src homology domain 3 (SH3) patterns. This protein interacts with Crk-associated substrate, and it appears to function in the control of cell division, as well as in cell-cell and cell-matrix adhesion signaling, likely as part of a multifunctional complex localized in actin- and microtubule-based structures. Mutations in this gene cause familial juvenile nephronophthisis type 1, a kidney disorder involving both tubules and glomeruli. Defects in this gene are also associated with Senior-Loken syndrome type 1, also referred to as juvenile nephronophthisis with Leber amaurosis, which is characterized by kidney and eye disease, and with Joubert syndrome type 4, which is characterized by cerebellar ataxia, oculomotor apraxia, psychomotor delay and neonatal breathing abnormalities, sometimes including retinal dystrophy and renal disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit male infertility due to defects in sperm maturation. Mice homozygous for another knock-out allele exhibit absent photoreceptor outer segment and photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 T C 11: 94,346,044 T1456A probably damaging Het
Acad11 T C 9: 104,073,645 F56S probably damaging Het
Adamts8 A G 9: 30,956,656 N592S possibly damaging Het
Amh A G 10: 80,806,921 D313G probably damaging Het
Ampd2 T C 3: 108,086,736 probably benign Het
Arap3 A G 18: 37,978,600 L1115P probably damaging Het
Arfgap1 C A 2: 180,981,076 D327E probably benign Het
Capns2 T A 8: 92,901,624 I47N possibly damaging Het
Cd163 T C 6: 124,327,903 S1080P possibly damaging Het
Ceacam10 A T 7: 24,781,008 Y68F possibly damaging Het
Cep44 G A 8: 56,538,617 P317S probably benign Het
Cfh A T 1: 140,100,875 Y688* probably null Het
Chrnb1 A T 11: 69,786,947 S326R probably damaging Het
Cngb1 C T 8: 95,299,716 V25M probably damaging Het
Cyp2c50 A T 19: 40,090,692 N160Y possibly damaging Het
Dalrd3 T C 9: 108,571,601 probably benign Het
Eef1d C A 15: 75,902,799 S253I possibly damaging Het
Efl1 G A 7: 82,763,283 C960Y probably damaging Het
Elmo1 C G 13: 20,600,212 Y646* probably null Het
Epb41l2 C A 10: 25,506,180 D701E possibly damaging Het
Fbxl4 T A 4: 22,422,699 probably null Het
Fhod1 T C 8: 105,337,351 probably benign Het
Gm21761 C A 13: 119,912,372 L127F probably damaging Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Igkv10-95 A T 6: 68,680,622 I21F probably damaging Het
Il10rb C A 16: 91,407,715 N51K possibly damaging Het
Krt78 T C 15: 101,947,940 T479A probably benign Het
Lrig3 T C 10: 126,013,404 S998P probably benign Het
Lrrc8c T A 5: 105,607,889 M510K probably benign Het
Nfrkb G T 9: 31,399,962 C369F probably damaging Het
Olfr1307 T C 2: 111,945,189 H89R probably benign Het
Olfr713 A C 7: 107,036,491 E112A probably damaging Het
Ovol3 A T 7: 30,235,364 probably null Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Rims2 T C 15: 39,437,924 probably null Het
Sh3rf3 T C 10: 59,083,576 V505A probably benign Het
Shkbp1 T C 7: 27,343,302 N570S probably benign Het
Slc35f4 C T 14: 49,318,850 V149I possibly damaging Het
Snx27 A G 3: 94,562,023 F4L probably benign Het
Syvn1 C T 19: 6,049,921 probably benign Het
Tagap1 G A 17: 6,956,112 S395L probably benign Het
Tek A G 4: 94,863,667 T1014A probably damaging Het
Top2a A G 11: 99,001,405 I1077T probably benign Het
Tpo T C 12: 30,104,016 Y230C probably damaging Het
Trav12-2 A G 14: 53,616,875 Q102R possibly damaging Het
Ttn G A 2: 76,903,086 probably benign Het
Vmn1r183 A T 7: 24,055,548 I259F probably benign Het
Vmn1r228 T C 17: 20,776,599 E219G probably damaging Het
Vsig8 G T 1: 172,563,147 G254V probably damaging Het
Vwa8 A G 14: 79,082,806 I1086V probably benign Het
Zfp423 G A 8: 87,782,973 H123Y probably damaging Het
Zfp811 A T 17: 32,797,547 C506* probably null Het
Other mutations in Nphp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Nphp1 APN 2 127763885 missense probably damaging 0.99
IGL00589:Nphp1 APN 2 127763849 missense probably damaging 1.00
IGL01143:Nphp1 APN 2 127780136 missense probably benign 0.06
IGL01893:Nphp1 APN 2 127769644 missense probably damaging 1.00
IGL01922:Nphp1 APN 2 127780069 missense possibly damaging 0.95
IGL02123:Nphp1 APN 2 127754049 missense probably benign 0.03
IGL02340:Nphp1 APN 2 127780067 nonsense probably null
IGL02836:Nphp1 APN 2 127769623 missense probably benign 0.00
IGL03109:Nphp1 APN 2 127768169 critical splice donor site probably benign
R1632:Nphp1 UTSW 2 127770392 missense probably benign 0.32
R1857:Nphp1 UTSW 2 127770376 missense probably benign 0.00
R4514:Nphp1 UTSW 2 127748087 missense probably benign 0.26
R4546:Nphp1 UTSW 2 127766019 splice site probably null
R4580:Nphp1 UTSW 2 127768169 critical splice donor site probably null
R5634:Nphp1 UTSW 2 127759650 missense possibly damaging 0.81
R7152:Nphp1 UTSW 2 127753979 missense probably benign
R7326:Nphp1 UTSW 2 127761217 missense possibly damaging 0.76
X0022:Nphp1 UTSW 2 127761214 missense probably damaging 1.00
X0025:Nphp1 UTSW 2 127779127 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CGTTGACACCTGTTACACTTTG -3'
(R):5'- TTAGTGCAACCTGTGGCACG -3'

Sequencing Primer
(F):5'- CTGGCTAGTTTAGACAAGGGCC -3'
(R):5'- CCTGTGGCACGGGGTTG -3'
Posted On2016-02-16