Incidental Mutation 'R4241:Tcerg1l'
ID371167
Institutional Source Beutler Lab
Gene Symbol Tcerg1l
Ensembl Gene ENSMUSG00000091002
Gene Nametranscription elongation regulator 1-like
Synonyms5730476P14Rik
MMRRC Submission 041058-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4241 (G1)
Quality Score28
Status Validated
Chromosome7
Chromosomal Location138208974-138397730 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 138397632 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 8 (Q8K)
Ref Sequence ENSEMBL: ENSMUSP00000124476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160436]
Predicted Effect unknown
Transcript: ENSMUST00000160436
AA Change: Q8K
SMART Domains Protein: ENSMUSP00000124476
Gene: ENSMUSG00000091002
AA Change: Q8K

DomainStartEndE-ValueType
low complexity region 6 44 N/A INTRINSIC
low complexity region 52 97 N/A INTRINSIC
WW 146 178 2.11e1 SMART
low complexity region 235 249 N/A INTRINSIC
WW 344 376 3.29e-4 SMART
low complexity region 402 415 N/A INTRINSIC
FF 454 507 4.57e-12 SMART
FF 520 574 1.53e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162222
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,154,335 S1575G probably damaging Het
Agl A T 3: 116,754,848 probably benign Het
Ap5b1 C T 19: 5,568,797 L82F possibly damaging Het
Arfgef3 A G 10: 18,625,164 S1113P probably damaging Het
Atoh1 A C 6: 64,729,774 N151T probably damaging Het
Bcas3 T A 11: 85,470,826 S25R probably damaging Het
Blcap T A 2: 157,560,423 probably benign Het
Btbd6 C T 12: 112,976,796 A13V probably benign Het
Ccdc83 A C 7: 90,247,138 N74K probably damaging Het
Cdh9 A G 15: 16,849,079 probably null Het
Chd1 C T 17: 15,770,027 R1614* probably null Het
Col16a1 G T 4: 130,099,050 Q1567H probably damaging Het
Coq6 A T 12: 84,373,789 probably benign Het
Cpd T C 11: 76,846,785 D61G probably benign Het
Csnk1e A G 15: 79,424,895 F277S probably damaging Het
Cyp2d41-ps T A 15: 82,779,586 noncoding transcript Het
Dbt T C 3: 116,533,296 I98T probably damaging Het
Eif3e G A 15: 43,262,690 T287I probably damaging Het
Gm7135 A G 1: 97,353,953 noncoding transcript Het
Gpr176 A T 2: 118,279,610 S389R probably benign Het
Hax1 A G 3: 89,995,690 S257P probably damaging Het
Herc1 CTGAGGACTCTTTG CTG 9: 66,448,348 probably null Het
Ighv1-53 C T 12: 115,158,822 C5Y probably benign Het
Klhl13 T A X: 23,315,175 D2V probably damaging Het
Kynu A T 2: 43,681,410 H446L probably benign Het
Lingo1 A G 9: 56,620,102 F401S probably damaging Het
Lmbrd1 C T 1: 24,692,968 Q89* probably null Het
Mov10 T A 3: 104,797,276 Q773L probably benign Het
Olfr1356 T A 10: 78,847,905 R3S probably benign Het
Olfr596 G T 7: 103,310,661 *313Y probably null Het
Pde6c G A 19: 38,162,845 G608S probably damaging Het
Peli3 T C 19: 4,932,398 H413R probably damaging Het
Pkdrej C T 15: 85,818,144 R1197Q probably damaging Het
Rcan2 T A 17: 43,953,479 V10D probably benign Het
Slc10a5 A G 3: 10,335,460 S47P probably damaging Het
Sprr3 A G 3: 92,456,907 V210A possibly damaging Het
Ubfd1 T C 7: 122,071,754 V265A possibly damaging Het
Ubr1 T C 2: 120,934,386 D529G possibly damaging Het
Vmn1r180 A T 7: 23,952,873 I154F probably damaging Het
Vmn1r237 A G 17: 21,314,663 H216R possibly damaging Het
Whrn C T 4: 63,432,973 probably benign Het
Zfr T G 15: 12,149,659 D388E probably damaging Het
Zic5 T C 14: 122,464,663 I219V probably benign Het
Zmat5 A G 11: 4,728,614 N53D probably benign Het
Other mutations in Tcerg1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Tcerg1l APN 7 138209804 missense probably damaging 0.99
IGL01402:Tcerg1l APN 7 138259839 missense probably damaging 0.98
IGL01510:Tcerg1l APN 7 138394305 splice site probably benign
IGL01638:Tcerg1l APN 7 138280076 missense probably damaging 1.00
IGL01710:Tcerg1l APN 7 138395060 missense possibly damaging 0.81
IGL02547:Tcerg1l APN 7 138248371 critical splice donor site probably null
IGL02887:Tcerg1l APN 7 138229890 missense probably damaging 1.00
IGL03105:Tcerg1l APN 7 138248444 splice site probably benign
IGL03348:Tcerg1l APN 7 138213371 missense probably damaging 0.97
R0378:Tcerg1l UTSW 7 138276655 missense probably benign 0.01
R1474:Tcerg1l UTSW 7 138280075 missense probably damaging 0.99
R1589:Tcerg1l UTSW 7 138361767 missense probably damaging 0.99
R1658:Tcerg1l UTSW 7 138394180 missense probably damaging 0.98
R1792:Tcerg1l UTSW 7 138361866 missense probably benign 0.07
R1807:Tcerg1l UTSW 7 138395097 missense probably benign 0.34
R2920:Tcerg1l UTSW 7 138248379 missense probably damaging 0.99
R3148:Tcerg1l UTSW 7 138259867 missense probably benign
R4106:Tcerg1l UTSW 7 138259944 missense probably damaging 0.99
R4180:Tcerg1l UTSW 7 138276676 critical splice acceptor site probably null
R4898:Tcerg1l UTSW 7 138218057 missense probably damaging 0.99
R5652:Tcerg1l UTSW 7 138280046 missense probably damaging 0.97
R6646:Tcerg1l UTSW 7 138395183 splice site probably null
R6824:Tcerg1l UTSW 7 138394115 critical splice donor site probably null
R7414:Tcerg1l UTSW 7 138218057 missense probably damaging 0.97
R7490:Tcerg1l UTSW 7 138259828 missense not run
Predicted Primers PCR Primer
(F):5'- ATAGGAAGGGACCCGCAATACC -3'
(R):5'- GAGCAATTGGCCACCAGTAG -3'

Sequencing Primer
(F):5'- TTACCTGTCCGTGGAGCAG -3'
(R):5'- AAATCAGCCGGCTGGGTTG -3'
Posted On2016-02-29