Mutagenetix > Incidental Mutations

Incidental Mutation 'R4822:Klhl20'

371175

Institutional Source

Beutler Lab

Gene Symbol

Klhl20

Ensembl Gene

ENSMUSG00000026705

Gene Name

kelch-like 20

Synonyms

D930050H05Rik

MMRRC Submission

042438-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.163) question?

Stock #

R4822 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

161088375-161131511 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 161093763 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 41 (Q41*)

Ref Sequence

ENSEMBL: ENSMUSP00000141213 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111611] [ENSMUST00000117467] [ENSMUST00000195584]

Predicted Effect

probably null
Transcript: ENSMUST00000111611
AA Change: Q550*

SMART Domains

Protein: ENSMUSP00000107238
Gene: ENSMUSG00000026705
AA Change: Q550*

Domain	Start	End	E-Value	Type
BTB	63	160	2.73e-31	SMART
BACK	165	267	1.98e-41	SMART
Kelch	314	360	8.45e-16	SMART
Kelch	361	408	1.35e-14	SMART
Kelch	409	455	5.12e-15	SMART
Kelch	456	502	1.22e-12	SMART
Kelch	503	549	1.35e-14	SMART
Kelch	550	596	1.59e-11	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000117467
AA Change: Q550*

SMART Domains

Protein: ENSMUSP00000114044
Gene: ENSMUSG00000026705
AA Change: Q550*

Domain	Start	End	E-Value	Type
BTB	63	160	2.73e-31	SMART
BACK	165	267	1.98e-41	SMART
Kelch	314	360	8.45e-16	SMART
Kelch	361	408	1.35e-14	SMART
Kelch	409	455	5.12e-15	SMART
Kelch	456	502	1.22e-12	SMART
Kelch	503	549	1.35e-14	SMART
Kelch	550	596	1.59e-11	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140905

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148952

Predicted Effect

probably null
Transcript: ENSMUST00000195584
AA Change: Q41*

SMART Domains

Protein: ENSMUSP00000141213
Gene: ENSMUSG00000026705
AA Change: Q41*

Domain	Start	End	E-Value	Type
Kelch	1	40	1.43e-4	SMART
Kelch	41	87	1.59e-11	SMART

Meta Mutation Damage Score

0.59

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.7%

Validation Efficiency

98% (101/103)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kelch family of proteins, which is characterized by a 44-56 amino acid repeat motif. The kelch motif appears in many different polypeptide contexts and contains multiple potential protein-protein contact sites. Members of this family are present both throughout the cell and extracellularly, with diverse activities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit male sterility. Mice homozygous for a gene trap allele exhibit corneal vascularization and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930012K11Rik	C	T	14: 70,156,458	V243I	probably benign	Het
Acadvl	C	T	11: 70,011,184	G485S	probably benign	Het
Acap3	T	A	4: 155,902,451		probably benign	Het
Adamts19	A	G	18: 58,890,284	I250M	probably damaging	Het
AF067061	A	T	13: 120,264,150	T117S	probably damaging	Het
Amacr	T	A	15: 10,983,410	I102N	probably damaging	Het
Apob	A	G	12: 8,015,741	T4237A	probably benign	Het
Bbs10	A	G	10: 111,301,134	K703E	probably benign	Het
Bicd1	A	T	6: 149,519,254		probably benign	Het
Caskin2	T	A	11: 115,807,299	E49V	probably damaging	Het
Cemip	T	A	7: 83,973,241	I577F	probably benign	Het
Chrnb1	T	C	11: 69,795,675	S40G	possibly damaging	Het
Ctif	C	T	18: 75,521,561	C298Y	probably benign	Het
Cul9	A	C	17: 46,530,051	H764Q	probably benign	Het
Cwf19l2	T	A	9: 3,458,839	C763S	probably damaging	Het
Dhx57	A	T	17: 80,242,167		probably null	Het
Dnhd1	G	A	7: 105,703,964	D2775N	probably benign	Het
Enpp1	A	T	10: 24,661,935	M384K	possibly damaging	Het
Fat2	T	C	11: 55,311,318	N310S	probably benign	Het
Fbxw7	A	T	3: 84,967,507	Y232F	possibly damaging	Het
Fcamr	T	A	1: 130,812,686	S281T	possibly damaging	Het
Gm10762	C	T	2: 128,967,186	W81*	probably null	Het
Gm5592	A	G	7: 41,155,890		probably benign	Het
Gm5745	T	C	9: 73,175,698		noncoding transcript	Het
Gm6185	G	C	1: 161,213,254		noncoding transcript	Het
Hid1	T	A	11: 115,355,299	N382Y	probably damaging	Het
Hoxa10	A	T	6: 52,232,589	F68I	probably damaging	Het
Ift88	T	A	14: 57,441,869		probably null	Het
Ighg2b	A	T	12: 113,306,391	*336R	probably null	Het
Ighv7-2	A	C	12: 113,912,272	L37R	probably damaging	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Kcnn3	G	C	3: 89,667,289	V703L	possibly damaging	Het
Kiz	C	A	2: 146,891,069	S388R	probably damaging	Het
Krt31	T	C	11: 100,047,784	I328V	possibly damaging	Het
Lama4	A	T	10: 39,033,053	I330L	probably benign	Het
Lipo2	A	T	19: 33,745,751	S213T	probably benign	Het
Lrsam1	A	T	2: 32,926,792	I723N	probably damaging	Het
Man2b2	G	A	5: 36,815,521	R550W	probably damaging	Het
Map4k5	A	T	12: 69,841,984	L224*	probably null	Het
Mast3	A	G	8: 70,780,366	S1101P	probably damaging	Het
Mertk	A	G	2: 128,801,305	S875G	probably benign	Het
Mmel1	A	G	4: 154,887,897	M302V	probably benign	Het
Mrgpra3	T	A	7: 47,589,968	H70L	possibly damaging	Het
Myh3	T	A	11: 67,089,010	S592T	probably benign	Het
Nbeal2	T	C	9: 110,636,315	I451V	possibly damaging	Het
Nup155	T	A	15: 8,128,526	V489D	possibly damaging	Het
Obscn	T	A	11: 59,022,333	T6300S	probably benign	Het
Olfr1294	G	T	2: 111,537,452	T279K	probably damaging	Het
Olfr1377	T	A	11: 50,985,083	C127*	probably null	Het
Olfr290	A	C	7: 84,916,426	I216L	possibly damaging	Het
Olfr350	A	G	2: 36,850,876	M277V	probably benign	Het
Oprm1	A	G	10: 6,829,036	I146V	probably damaging	Het
Otub1	A	T	19: 7,204,429	D27E	probably damaging	Het
Pik3ca	T	C	3: 32,437,982	V243A	probably benign	Het
Pla2g12b	G	A	10: 59,416,514		probably null	Het
Plekha8	A	G	6: 54,624,561	D321G	probably damaging	Het
Pprc1	T	C	19: 46,071,356		probably benign	Het
Prkdc	A	G	16: 15,650,712	D129G	possibly damaging	Het
Rbms3	C	T	9: 116,944,373		probably benign	Het
Rictor	T	A	15: 6,791,680	V1495D	probably benign	Het
Rpl31-ps21	T	C	5: 21,119,509		noncoding transcript	Het
Ryr3	A	T	2: 112,652,745	I4219N	probably damaging	Het
Sbf2	G	A	7: 110,377,939		probably benign	Het
Scn10a	C	T	9: 119,638,672	A801T	probably damaging	Het
Scn9a	T	A	2: 66,483,749	Y1866F	possibly damaging	Het
Sec1	A	C	7: 45,679,303	Y107D	probably damaging	Het
Sema6d	C	T	2: 124,662,294	T619M	possibly damaging	Het
Sh2b3	C	A	5: 121,828,555		probably benign	Het
Slc2a4	A	G	11: 69,946,587	V44A	probably damaging	Het
Slc5a12	T	C	2: 110,621,740	I326T	possibly damaging	Het
Smarca5	T	C	8: 80,708,680		probably null	Het
Smarcd2	A	G	11: 106,266,531		probably null	Het
Snrpa1	A	T	7: 66,069,573		probably benign	Het
Sptbn5	T	G	2: 120,067,968	K470Q	probably benign	Het
Stard9	T	G	2: 120,695,941	V893G	possibly damaging	Het
Stx8	T	G	11: 67,973,273	V53G	possibly damaging	Het
Sv2c	A	T	13: 95,985,949	W440R	probably damaging	Het
Tmem181a	A	T	17: 6,280,665	I67F	probably benign	Het
Tmprss7	C	T	16: 45,663,316	C565Y	probably damaging	Het
Trafd1	A	T	5: 121,378,498	L109H	probably damaging	Het
Trpv4	A	G	5: 114,630,022	I422T	possibly damaging	Het
Usp24	T	A	4: 106,416,047	Y2210N	probably damaging	Het
Vmn1r236	A	T	17: 21,286,940	N107Y	probably damaging	Het
Vmn2r13	A	T	5: 109,174,072	I253K	probably damaging	Het
Vmn2r2	T	A	3: 64,134,539	I252F	probably damaging	Het
Vsig8	A	G	1: 172,559,638	D27G	probably damaging	Het
Wdr92	T	A	11: 17,227,165	N174K	probably damaging	Het
Wiz	A	T	17: 32,356,437	Y908*	probably null	Het
Wnk1	A	T	6: 119,962,438	S1113T	probably benign	Het
Zdhhc1	CGGGGG	CGGGGGG	8: 105,483,744		probably null	Het
Zfp691	G	T	4: 119,170,567	T156K	probably damaging	Het
Zfp791	A	T	8: 85,110,406	D276E	probably benign	Het

Other mutations in Klhl20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00777:Klhl20	APN	1	161109755	missense	probably benign	0.00
IGL00903:Klhl20	APN	1	161090506	missense	probably benign	0.00
IGL01574:Klhl20	APN	1	161093726	missense	probably damaging	1.00
IGL01721:Klhl20	APN	1	161095587	missense	probably damaging	1.00
IGL01933:Klhl20	APN	1	161106787	missense	probably damaging	1.00
IGL02187:Klhl20	APN	1	161109710	missense	probably benign	0.05
IGL02634:Klhl20	APN	1	161098365	missense	probably damaging	0.98
IGL02691:Klhl20	APN	1	161106874	splice site	probably benign
R0102:Klhl20	UTSW	1	161090445	nonsense	probably null
R0102:Klhl20	UTSW	1	161090445	nonsense	probably null
R0639:Klhl20	UTSW	1	161093711	missense	probably damaging	1.00
R1730:Klhl20	UTSW	1	161102990	missense	possibly damaging	0.82
R1856:Klhl20	UTSW	1	161106742	missense	probably benign	0.00
R2016:Klhl20	UTSW	1	161103038	missense	probably damaging	0.98
R2901:Klhl20	UTSW	1	161109552	nonsense	probably null
R4830:Klhl20	UTSW	1	161098376	missense	probably benign	0.00
R4894:Klhl20	UTSW	1	161109532	missense	possibly damaging	0.76
R4981:Klhl20	UTSW	1	161103005	missense	possibly damaging	0.48
R5018:Klhl20	UTSW	1	161101586	missense	probably damaging	0.98
R5023:Klhl20	UTSW	1	161109220	critical splice donor site	probably null
R5108:Klhl20	UTSW	1	161099250	missense	probably damaging	0.99
R5216:Klhl20	UTSW	1	161093679	critical splice donor site	probably null
R5659:Klhl20	UTSW	1	161090470	missense	probably damaging	1.00
R6159:Klhl20	UTSW	1	161105467	missense	probably damaging	1.00
R6836:Klhl20	UTSW	1	161105406	missense	probably benign	0.18
R6914:Klhl20	UTSW	1	161093696	missense	possibly damaging	0.50
R6915:Klhl20	UTSW	1	161093696	missense	possibly damaging	0.50
R6920:Klhl20	UTSW	1	161093696	missense	possibly damaging	0.50

Predicted Primers

PCR Primer
(F):5'- CCACGTGAGGATGTAAGTTGG -3'
(R):5'- GACTCTGCTTAGGCGCATATG -3'

Sequencing Primer
(F):5'- AGGATGTAAGTTGGCTATCCCAC -3'
(R):5'- TAGGCGCATATGTTAATAAAAGGCC -3'

Posted On

2016-03-01