Incidental Mutation 'R4822:Fbxw7'
ID371192
Institutional Source Beutler Lab
Gene Symbol Fbxw7
Ensembl Gene ENSMUSG00000028086
Gene NameF-box and WD-40 domain protein 7
SynonymsFbw7, 1110001A17Rik, AGO, Cdc4, Fbxw6, SEL-10, Fbxo30
MMRRC Submission 042438-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4822 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location84815268-84979198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84967507 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 232 (Y232F)
Ref Sequence ENSEMBL: ENSMUSP00000029727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029727] [ENSMUST00000107675] [ENSMUST00000107678] [ENSMUST00000107679] [ENSMUST00000154148]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029727
AA Change: Y232F

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029727
Gene: ENSMUSG00000028086
AA Change: Y232F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 139 146 N/A INTRINSIC
FBOX 206 246 3.7e-8 SMART
WD40 291 329 3.14e-6 SMART
WD40 332 369 2.1e-7 SMART
WD40 372 409 7.55e-9 SMART
WD40 412 449 2.22e-6 SMART
WD40 452 489 1.07e-8 SMART
WD40 492 529 1.75e-4 SMART
WD40 532 572 2.32e-9 SMART
WD40 575 623 2.37e2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107675
AA Change: Y192F

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103302
Gene: ENSMUSG00000028086
AA Change: Y192F

DomainStartEndE-ValueType
low complexity region 99 106 N/A INTRINSIC
FBOX 166 206 3.7e-8 SMART
WD40 251 289 3.14e-6 SMART
WD40 292 329 2.1e-7 SMART
WD40 332 369 7.55e-9 SMART
WD40 372 409 2.22e-6 SMART
WD40 412 449 1.07e-8 SMART
WD40 452 489 1.75e-4 SMART
WD40 492 532 2.32e-9 SMART
WD40 535 583 2.37e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107678
AA Change: Y313F

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103305
Gene: ENSMUSG00000028086
AA Change: Y313F

DomainStartEndE-ValueType
coiled coil region 94 129 N/A INTRINSIC
low complexity region 220 227 N/A INTRINSIC
FBOX 287 327 3.7e-8 SMART
WD40 372 410 3.14e-6 SMART
WD40 413 450 2.1e-7 SMART
WD40 453 490 7.55e-9 SMART
WD40 493 530 2.22e-6 SMART
WD40 533 570 1.07e-8 SMART
WD40 573 610 1.75e-4 SMART
WD40 613 653 2.32e-9 SMART
WD40 656 704 2.37e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107679
AA Change: Y313F

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103306
Gene: ENSMUSG00000028086
AA Change: Y313F

DomainStartEndE-ValueType
coiled coil region 94 129 N/A INTRINSIC
low complexity region 220 227 N/A INTRINSIC
FBOX 287 327 3.7e-8 SMART
WD40 372 410 3.14e-6 SMART
WD40 413 450 2.1e-7 SMART
WD40 453 490 7.55e-9 SMART
WD40 493 530 2.22e-6 SMART
WD40 533 570 1.07e-8 SMART
WD40 573 610 1.75e-4 SMART
WD40 613 653 2.32e-9 SMART
WD40 656 704 2.37e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151410
Predicted Effect probably benign
Transcript: ENSMUST00000154148
SMART Domains Protein: ENSMUSP00000116393
Gene: ENSMUSG00000102805

DomainStartEndE-ValueType
Arfaptin 1 227 7.15e-121 SMART
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (101/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene was previously referred to as FBX30, and belongs to the Fbws class; in addition to an F-box, this protein contains 7 tandem WD40 repeats. This protein binds directly to cyclin E and probably targets cyclin E for ubiquitin-mediated degradation. Mutations in this gene are detected in ovarian and breast cancer cell lines, implicating the gene's potential role in the pathogenesis of human cancers. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous inactivation of this locus disrupts embryonic and extraembryonic vasculature, resulting in death by midgestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik C T 14: 70,156,458 V243I probably benign Het
Acadvl C T 11: 70,011,184 G485S probably benign Het
Acap3 T A 4: 155,902,451 probably benign Het
Adamts19 A G 18: 58,890,284 I250M probably damaging Het
AF067061 A T 13: 120,264,150 T117S probably damaging Het
Amacr T A 15: 10,983,410 I102N probably damaging Het
Apob A G 12: 8,015,741 T4237A probably benign Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Bicd1 A T 6: 149,519,254 probably benign Het
Caskin2 T A 11: 115,807,299 E49V probably damaging Het
Cemip T A 7: 83,973,241 I577F probably benign Het
Chrnb1 T C 11: 69,795,675 S40G possibly damaging Het
Ctif C T 18: 75,521,561 C298Y probably benign Het
Cul9 A C 17: 46,530,051 H764Q probably benign Het
Cwf19l2 T A 9: 3,458,839 C763S probably damaging Het
Dhx57 A T 17: 80,242,167 probably null Het
Dnhd1 G A 7: 105,703,964 D2775N probably benign Het
Enpp1 A T 10: 24,661,935 M384K possibly damaging Het
Fat2 T C 11: 55,311,318 N310S probably benign Het
Fcamr T A 1: 130,812,686 S281T possibly damaging Het
Gm10762 C T 2: 128,967,186 W81* probably null Het
Gm5592 A G 7: 41,155,890 probably benign Het
Gm5745 T C 9: 73,175,698 noncoding transcript Het
Gm6185 G C 1: 161,213,254 noncoding transcript Het
Hid1 T A 11: 115,355,299 N382Y probably damaging Het
Hoxa10 A T 6: 52,232,589 F68I probably damaging Het
Ift88 T A 14: 57,441,869 probably null Het
Ighg2b A T 12: 113,306,391 *336R probably null Het
Ighv7-2 A C 12: 113,912,272 L37R probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnn3 G C 3: 89,667,289 V703L possibly damaging Het
Kiz C A 2: 146,891,069 S388R probably damaging Het
Klhl20 G A 1: 161,093,763 Q41* probably null Het
Krt31 T C 11: 100,047,784 I328V possibly damaging Het
Lama4 A T 10: 39,033,053 I330L probably benign Het
Lipo2 A T 19: 33,745,751 S213T probably benign Het
Lrsam1 A T 2: 32,926,792 I723N probably damaging Het
Man2b2 G A 5: 36,815,521 R550W probably damaging Het
Map4k5 A T 12: 69,841,984 L224* probably null Het
Mast3 A G 8: 70,780,366 S1101P probably damaging Het
Mertk A G 2: 128,801,305 S875G probably benign Het
Mmel1 A G 4: 154,887,897 M302V probably benign Het
Mrgpra3 T A 7: 47,589,968 H70L possibly damaging Het
Myh3 T A 11: 67,089,010 S592T probably benign Het
Nbeal2 T C 9: 110,636,315 I451V possibly damaging Het
Nup155 T A 15: 8,128,526 V489D possibly damaging Het
Obscn T A 11: 59,022,333 T6300S probably benign Het
Olfr1294 G T 2: 111,537,452 T279K probably damaging Het
Olfr1377 T A 11: 50,985,083 C127* probably null Het
Olfr290 A C 7: 84,916,426 I216L possibly damaging Het
Olfr350 A G 2: 36,850,876 M277V probably benign Het
Oprm1 A G 10: 6,829,036 I146V probably damaging Het
Otub1 A T 19: 7,204,429 D27E probably damaging Het
Pik3ca T C 3: 32,437,982 V243A probably benign Het
Pla2g12b G A 10: 59,416,514 probably null Het
Plekha8 A G 6: 54,624,561 D321G probably damaging Het
Pprc1 T C 19: 46,071,356 probably benign Het
Prkdc A G 16: 15,650,712 D129G possibly damaging Het
Rbms3 C T 9: 116,944,373 probably benign Het
Rictor T A 15: 6,791,680 V1495D probably benign Het
Rpl31-ps21 T C 5: 21,119,509 noncoding transcript Het
Ryr3 A T 2: 112,652,745 I4219N probably damaging Het
Sbf2 G A 7: 110,377,939 probably benign Het
Scn10a C T 9: 119,638,672 A801T probably damaging Het
Scn9a T A 2: 66,483,749 Y1866F possibly damaging Het
Sec1 A C 7: 45,679,303 Y107D probably damaging Het
Sema6d C T 2: 124,662,294 T619M possibly damaging Het
Sh2b3 C A 5: 121,828,555 probably benign Het
Slc2a4 A G 11: 69,946,587 V44A probably damaging Het
Slc5a12 T C 2: 110,621,740 I326T possibly damaging Het
Smarca5 T C 8: 80,708,680 probably null Het
Smarcd2 A G 11: 106,266,531 probably null Het
Snrpa1 A T 7: 66,069,573 probably benign Het
Sptbn5 T G 2: 120,067,968 K470Q probably benign Het
Stard9 T G 2: 120,695,941 V893G possibly damaging Het
Stx8 T G 11: 67,973,273 V53G possibly damaging Het
Sv2c A T 13: 95,985,949 W440R probably damaging Het
Tmem181a A T 17: 6,280,665 I67F probably benign Het
Tmprss7 C T 16: 45,663,316 C565Y probably damaging Het
Trafd1 A T 5: 121,378,498 L109H probably damaging Het
Trpv4 A G 5: 114,630,022 I422T possibly damaging Het
Usp24 T A 4: 106,416,047 Y2210N probably damaging Het
Vmn1r236 A T 17: 21,286,940 N107Y probably damaging Het
Vmn2r13 A T 5: 109,174,072 I253K probably damaging Het
Vmn2r2 T A 3: 64,134,539 I252F probably damaging Het
Vsig8 A G 1: 172,559,638 D27G probably damaging Het
Wdr92 T A 11: 17,227,165 N174K probably damaging Het
Wiz A T 17: 32,356,437 Y908* probably null Het
Wnk1 A T 6: 119,962,438 S1113T probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp691 G T 4: 119,170,567 T156K probably damaging Het
Zfp791 A T 8: 85,110,406 D276E probably benign Het
Other mutations in Fbxw7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Fbxw7 APN 3 84969309 intron probably benign
IGL01468:Fbxw7 APN 3 84972499 missense probably benign 0.21
IGL01946:Fbxw7 APN 3 84904062 missense possibly damaging 0.60
IGL02248:Fbxw7 APN 3 84903633 missense possibly damaging 0.94
IGL02630:Fbxw7 APN 3 84965279 missense probably damaging 1.00
IGL02957:Fbxw7 APN 3 84976237 missense probably benign 0.00
R0043:Fbxw7 UTSW 3 84972567 intron probably benign
R0312:Fbxw7 UTSW 3 84967569 intron probably benign
R0595:Fbxw7 UTSW 3 84977367 intron probably null
R1664:Fbxw7 UTSW 3 84969171 missense possibly damaging 0.45
R1709:Fbxw7 UTSW 3 84976352 missense probably damaging 1.00
R1782:Fbxw7 UTSW 3 84903819 missense probably benign
R1974:Fbxw7 UTSW 3 84954935 missense possibly damaging 0.53
R2081:Fbxw7 UTSW 3 84974513 missense probably damaging 1.00
R2843:Fbxw7 UTSW 3 84976220 missense probably damaging 1.00
R3732:Fbxw7 UTSW 3 84925707 missense possibly damaging 0.72
R3732:Fbxw7 UTSW 3 84925707 missense possibly damaging 0.72
R3733:Fbxw7 UTSW 3 84925707 missense possibly damaging 0.72
R4333:Fbxw7 UTSW 3 84972495 missense probably damaging 1.00
R4335:Fbxw7 UTSW 3 84972495 missense probably damaging 1.00
R4581:Fbxw7 UTSW 3 84967545 missense probably benign 0.41
R4776:Fbxw7 UTSW 3 84925689 missense possibly damaging 0.53
R4799:Fbxw7 UTSW 3 84903861 nonsense probably null
R5512:Fbxw7 UTSW 3 84954909 missense probably damaging 0.99
R5601:Fbxw7 UTSW 3 84976208 missense probably damaging 1.00
R5679:Fbxw7 UTSW 3 84977487 missense probably damaging 1.00
R6026:Fbxw7 UTSW 3 84952641 critical splice donor site probably null
R6182:Fbxw7 UTSW 3 84815771 critical splice donor site probably null
R6219:Fbxw7 UTSW 3 84969213 missense probably damaging 0.99
R6305:Fbxw7 UTSW 3 84976323 missense probably damaging 1.00
R6473:Fbxw7 UTSW 3 84952380 intron probably benign
R6823:Fbxw7 UTSW 3 84958627 missense probably benign 0.33
R6922:Fbxw7 UTSW 3 84972416 intron probably null
Predicted Primers PCR Primer
(F):5'- TGAAATGCAGTAGTCCTAGCAAGATG -3'
(R):5'- AAATCAGGTGGCCTCCTTTCC -3'

Sequencing Primer
(F):5'- TGCTCAGCCTGGGTAGAGTAAC -3'
(R):5'- TCCTGTTGGGATCAAGGAAGTGAAC -3'
Posted On2016-03-01