Incidental Mutation 'R0422:Napsa'
ID37121
Institutional Source Beutler Lab
Gene Symbol Napsa
Ensembl Gene ENSMUSG00000002204
Gene Namenapsin A aspartic peptidase
SynonymsKdap, NAP1, napsin, pronapsin
MMRRC Submission 038624-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R0422 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location44572380-44586862 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 44585106 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 254 (Q254P)
Ref Sequence ENSEMBL: ENSMUSP00000002274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002274] [ENSMUST00000208514]
Predicted Effect probably damaging
Transcript: ENSMUST00000002274
AA Change: Q254P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002274
Gene: ENSMUSG00000002204
AA Change: Q254P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Asp 72 396 6.6e-109 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207543
Predicted Effect probably benign
Transcript: ENSMUST00000208514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209101
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase A1 family of aspartic proteases. The encoded preproprotein is proteolytically processed to generate an activation peptide and the mature protease. The activation peptides of aspartic proteinases function as inhibitors of the protease active site. These peptide segments, or pro-parts, are deemed important for correct folding, targeting, and control of the activation of aspartic proteinase zymogens. The encoded protease may play a role in the proteolytic processing of pulmonary surfactant protein B in the lung and may function in protein catabolism in the renal proximal tubules. This gene has been described as a marker for lung adenocarcinoma and renal cell carcinoma. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,199 S511P possibly damaging Het
Acsm3 T A 7: 119,773,740 Y155* probably null Het
Adamts16 A G 13: 70,738,955 C937R probably damaging Het
Akna T C 4: 63,392,154 D451G probably damaging Het
Alox12 A T 11: 70,254,558 V63E probably damaging Het
Ap3b1 T C 13: 94,462,460 I514T probably damaging Het
Arhgap23 T C 11: 97,463,652 M286T probably damaging Het
Cdkl2 T C 5: 92,020,312 D341G probably benign Het
Clip2 T C 5: 134,498,113 D813G probably benign Het
Cntnap3 A G 13: 64,757,285 V894A probably damaging Het
Coro2b T A 9: 62,427,977 Y304F probably benign Het
Dclre1a T A 19: 56,544,135 K676* probably null Het
Dmxl2 A G 9: 54,399,940 probably null Het
Dpep3 A G 8: 105,976,118 probably null Het
Efna5 C T 17: 62,607,419 A177T probably benign Het
Fabp1 G A 6: 71,203,093 V83I possibly damaging Het
H2-DMa G T 17: 34,137,947 G140C probably damaging Het
Hectd4 T A 5: 121,343,082 probably null Het
Hyou1 T A 9: 44,389,242 N869K probably damaging Het
Ing1 G A 8: 11,561,933 V124I probably damaging Het
Kalrn T A 16: 34,314,273 I380F probably damaging Het
Kcnh1 A G 1: 192,337,580 I378V probably benign Het
Kmt2c A G 5: 25,315,664 V1816A probably benign Het
Matn2 G A 15: 34,435,771 probably null Het
Naip2 C T 13: 100,161,113 S805N probably benign Het
Nat10 G T 2: 103,726,729 S860* probably null Het
Nipbl T C 15: 8,351,628 D560G probably benign Het
Nr3c2 A G 8: 77,185,967 M736V probably benign Het
Olfr1294 A T 2: 111,537,983 F102Y probably damaging Het
Olfr52 A T 2: 86,181,222 D296E probably benign Het
Olfr868 A T 9: 20,101,448 R230* probably null Het
Palm3 A G 8: 84,028,863 S335G possibly damaging Het
Panx1 G T 9: 15,007,816 S249* probably null Het
Parvb A G 15: 84,295,611 T231A probably benign Het
Pcdhb11 G T 18: 37,421,870 L84F probably damaging Het
Pi4k2b T C 5: 52,767,754 *447Q probably null Het
Ppp1r1a A G 15: 103,532,356 S125P probably benign Het
Prss1 T A 6: 41,463,312 D194E probably damaging Het
Rnf216 A T 5: 143,015,654 C772* probably null Het
Rnf216 A T 5: 143,090,370 F253Y probably benign Het
Rsf1 A T 7: 97,680,817 E1183D probably benign Het
Rusc1 T C 3: 89,086,825 T958A probably benign Het
Rxfp1 A G 3: 79,650,731 M480T probably benign Het
Slc22a16 T A 10: 40,591,890 V473E probably damaging Het
Slc26a3 A G 12: 31,465,849 T583A possibly damaging Het
Slc7a15 T C 12: 8,534,400 T117A probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Slitrk6 T A 14: 110,752,293 probably benign Het
Spata7 A G 12: 98,658,265 Y110C probably damaging Het
Supt16 T A 14: 52,183,996 I31F probably benign Het
Taar7a T C 10: 23,993,274 T70A probably benign Het
Top2a A G 11: 99,009,853 F594L probably damaging Het
Unc13d C T 11: 116,070,020 probably null Het
Unc80 T G 1: 66,483,338 V233G probably damaging Het
Wdr91 A T 6: 34,880,846 D735E probably damaging Het
Zzef1 A G 11: 72,866,091 T1141A possibly damaging Het
Other mutations in Napsa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Napsa APN 7 44581421 missense probably benign 0.00
IGL01380:Napsa APN 7 44586674 missense probably damaging 0.99
IGL01521:Napsa APN 7 44586637 missense probably damaging 1.00
IGL01630:Napsa APN 7 44586665 missense probably damaging 1.00
IGL01862:Napsa APN 7 44582493 missense probably damaging 0.99
IGL01935:Napsa APN 7 44586622 missense probably benign 0.01
IGL02421:Napsa APN 7 44585055 missense probably damaging 1.00
IGL02831:Napsa APN 7 44586760 missense probably benign
IGL03008:Napsa APN 7 44585796 missense possibly damaging 0.77
PIT4131001:Napsa UTSW 7 44581451 missense probably damaging 1.00
R1542:Napsa UTSW 7 44581689 missense probably damaging 1.00
R1564:Napsa UTSW 7 44586649 missense probably damaging 1.00
R1903:Napsa UTSW 7 44581736 missense probably damaging 1.00
R1964:Napsa UTSW 7 44581685 missense probably benign 0.01
R2366:Napsa UTSW 7 44582485 missense probably damaging 1.00
R3713:Napsa UTSW 7 44581428 missense probably damaging 1.00
R5441:Napsa UTSW 7 44581393 unclassified probably benign
R5512:Napsa UTSW 7 44572616 start codon destroyed probably null 0.01
R5682:Napsa UTSW 7 44585344 missense possibly damaging 0.92
R6290:Napsa UTSW 7 44581337 missense probably benign 0.00
R7046:Napsa UTSW 7 44585085 missense probably damaging 1.00
R7134:Napsa UTSW 7 44585735 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAGCCAACTGGAGGAAGTCCCATC -3'
(R):5'- TTCAGCACCAGGAGTAGTCCTCAC -3'

Sequencing Primer
(F):5'- GAGGAAGTCCCATCCCAGAC -3'
(R):5'- AATGGCTTTATTCAAGGCCCG -3'
Posted On2013-05-09