Incidental Mutation 'R4822:Olfr290'
ID371212
Institutional Source Beutler Lab
Gene Symbol Olfr290
Ensembl Gene ENSMUSG00000116179
Gene Name
SynonymsGA_x6K02T2NHDJ-11170115-11169168, MOR254-1
MMRRC Submission 042438-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R4822 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location84915781-84916728 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 84916426 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 216 (I216L)
Ref Sequence ENSEMBL: ENSMUSP00000149523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073468] [ENSMUST00000214501] [ENSMUST00000216184] [ENSMUST00000216367]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073468
AA Change: I216L

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000073172
Gene: ENSMUSG00000116179
AA Change: I216L

DomainStartEndE-ValueType
Pfam:7tm_4 31 309 8.4e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 304 1.2e-10 PFAM
Pfam:7tm_1 41 291 1.3e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173463
Predicted Effect possibly damaging
Transcript: ENSMUST00000214501
AA Change: I216L

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216184
AA Change: I216L

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216367
AA Change: I216L

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (101/103)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik C T 14: 70,156,458 V243I probably benign Het
Acadvl C T 11: 70,011,184 G485S probably benign Het
Acap3 T A 4: 155,902,451 probably benign Het
Adamts19 A G 18: 58,890,284 I250M probably damaging Het
AF067061 A T 13: 120,264,150 T117S probably damaging Het
Amacr T A 15: 10,983,410 I102N probably damaging Het
Apob A G 12: 8,015,741 T4237A probably benign Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Bicd1 A T 6: 149,519,254 probably benign Het
Caskin2 T A 11: 115,807,299 E49V probably damaging Het
Cemip T A 7: 83,973,241 I577F probably benign Het
Chrnb1 T C 11: 69,795,675 S40G possibly damaging Het
Ctif C T 18: 75,521,561 C298Y probably benign Het
Cul9 A C 17: 46,530,051 H764Q probably benign Het
Cwf19l2 T A 9: 3,458,839 C763S probably damaging Het
Dhx57 A T 17: 80,242,167 probably null Het
Dnhd1 G A 7: 105,703,964 D2775N probably benign Het
Enpp1 A T 10: 24,661,935 M384K possibly damaging Het
Fat2 T C 11: 55,311,318 N310S probably benign Het
Fbxw7 A T 3: 84,967,507 Y232F possibly damaging Het
Fcamr T A 1: 130,812,686 S281T possibly damaging Het
Gm10762 C T 2: 128,967,186 W81* probably null Het
Gm5592 A G 7: 41,155,890 probably benign Het
Gm5745 T C 9: 73,175,698 noncoding transcript Het
Gm6185 G C 1: 161,213,254 noncoding transcript Het
Hid1 T A 11: 115,355,299 N382Y probably damaging Het
Hoxa10 A T 6: 52,232,589 F68I probably damaging Het
Ift88 T A 14: 57,441,869 probably null Het
Ighg2b A T 12: 113,306,391 *336R probably null Het
Ighv7-2 A C 12: 113,912,272 L37R probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnn3 G C 3: 89,667,289 V703L possibly damaging Het
Kiz C A 2: 146,891,069 S388R probably damaging Het
Klhl20 G A 1: 161,093,763 Q41* probably null Het
Krt31 T C 11: 100,047,784 I328V possibly damaging Het
Lama4 A T 10: 39,033,053 I330L probably benign Het
Lipo2 A T 19: 33,745,751 S213T probably benign Het
Lrsam1 A T 2: 32,926,792 I723N probably damaging Het
Man2b2 G A 5: 36,815,521 R550W probably damaging Het
Map4k5 A T 12: 69,841,984 L224* probably null Het
Mast3 A G 8: 70,780,366 S1101P probably damaging Het
Mertk A G 2: 128,801,305 S875G probably benign Het
Mmel1 A G 4: 154,887,897 M302V probably benign Het
Mrgpra3 T A 7: 47,589,968 H70L possibly damaging Het
Myh3 T A 11: 67,089,010 S592T probably benign Het
Nbeal2 T C 9: 110,636,315 I451V possibly damaging Het
Nup155 T A 15: 8,128,526 V489D possibly damaging Het
Obscn T A 11: 59,022,333 T6300S probably benign Het
Olfr1294 G T 2: 111,537,452 T279K probably damaging Het
Olfr1377 T A 11: 50,985,083 C127* probably null Het
Olfr350 A G 2: 36,850,876 M277V probably benign Het
Oprm1 A G 10: 6,829,036 I146V probably damaging Het
Otub1 A T 19: 7,204,429 D27E probably damaging Het
Pik3ca T C 3: 32,437,982 V243A probably benign Het
Pla2g12b G A 10: 59,416,514 probably null Het
Plekha8 A G 6: 54,624,561 D321G probably damaging Het
Pprc1 T C 19: 46,071,356 probably benign Het
Prkdc A G 16: 15,650,712 D129G possibly damaging Het
Rbms3 C T 9: 116,944,373 probably benign Het
Rictor T A 15: 6,791,680 V1495D probably benign Het
Rpl31-ps21 T C 5: 21,119,509 noncoding transcript Het
Ryr3 A T 2: 112,652,745 I4219N probably damaging Het
Sbf2 G A 7: 110,377,939 probably benign Het
Scn10a C T 9: 119,638,672 A801T probably damaging Het
Scn9a T A 2: 66,483,749 Y1866F possibly damaging Het
Sec1 A C 7: 45,679,303 Y107D probably damaging Het
Sema6d C T 2: 124,662,294 T619M possibly damaging Het
Sh2b3 C A 5: 121,828,555 probably benign Het
Slc2a4 A G 11: 69,946,587 V44A probably damaging Het
Slc5a12 T C 2: 110,621,740 I326T possibly damaging Het
Smarca5 T C 8: 80,708,680 probably null Het
Smarcd2 A G 11: 106,266,531 probably null Het
Snrpa1 A T 7: 66,069,573 probably benign Het
Sptbn5 T G 2: 120,067,968 K470Q probably benign Het
Stard9 T G 2: 120,695,941 V893G possibly damaging Het
Stx8 T G 11: 67,973,273 V53G possibly damaging Het
Sv2c A T 13: 95,985,949 W440R probably damaging Het
Tmem181a A T 17: 6,280,665 I67F probably benign Het
Tmprss7 C T 16: 45,663,316 C565Y probably damaging Het
Trafd1 A T 5: 121,378,498 L109H probably damaging Het
Trpv4 A G 5: 114,630,022 I422T possibly damaging Het
Usp24 T A 4: 106,416,047 Y2210N probably damaging Het
Vmn1r236 A T 17: 21,286,940 N107Y probably damaging Het
Vmn2r13 A T 5: 109,174,072 I253K probably damaging Het
Vmn2r2 T A 3: 64,134,539 I252F probably damaging Het
Vsig8 A G 1: 172,559,638 D27G probably damaging Het
Wdr92 T A 11: 17,227,165 N174K probably damaging Het
Wiz A T 17: 32,356,437 Y908* probably null Het
Wnk1 A T 6: 119,962,438 S1113T probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp691 G T 4: 119,170,567 T156K probably damaging Het
Zfp791 A T 8: 85,110,406 D276E probably benign Het
Other mutations in Olfr290
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Olfr290 APN 7 84916370 missense probably damaging 0.99
IGL01322:Olfr290 APN 7 84916382 missense probably damaging 0.99
IGL01834:Olfr290 APN 7 84916652 missense probably damaging 1.00
IGL02556:Olfr290 APN 7 84916359 nonsense probably null
IGL03246:Olfr290 APN 7 84916711 missense probably benign 0.03
IGL03255:Olfr290 APN 7 84916517 missense possibly damaging 0.95
R0322:Olfr290 UTSW 7 84916313 missense probably damaging 1.00
R1253:Olfr290 UTSW 7 84916709 missense probably benign
R1652:Olfr290 UTSW 7 84916520 missense probably damaging 1.00
R1673:Olfr290 UTSW 7 84916117 missense probably damaging 0.97
R1891:Olfr290 UTSW 7 84916253 missense possibly damaging 0.93
R1895:Olfr290 UTSW 7 84916279 missense probably benign 0.01
R1946:Olfr290 UTSW 7 84916279 missense probably benign 0.01
R2128:Olfr290 UTSW 7 84916493 missense probably damaging 1.00
R4435:Olfr290 UTSW 7 84916021 missense probably benign 0.45
R4834:Olfr290 UTSW 7 84916283 missense probably damaging 1.00
R5354:Olfr290 UTSW 7 84916149 nonsense probably null
R5644:Olfr290 UTSW 7 84916119 missense probably benign 0.15
R5650:Olfr290 UTSW 7 84916418 missense possibly damaging 0.50
R5708:Olfr290 UTSW 7 84916183 missense possibly damaging 0.56
R6585:Olfr290 UTSW 7 84916462 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGCTGGGTTTCTGAACTCC -3'
(R):5'- AACATGGGAGTAATGACCCCATAC -3'

Sequencing Primer
(F):5'- GAACTCCTTTGTCCACACAATG -3'
(R):5'- AGAGATGAGTCTGTCTCTACCAG -3'
Posted On2016-03-01